,Photoshop 3.08BIM,,7http://ns.adobe.com/xap/1.0/ image/jpeg [낱장]비오비타2종(소비자용)-팜플렛-135x190(6P)-2005 2020-06-09T09:50:59+09:00 2020-06-09T00:51:00Z 2020-06-09T09:50:59+09:00 Adobe Illustrator CS6 (Macintosh) 256 80 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAUAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYqw 78w0sXfRlvqG0Ny/qhiVH92aVI7Vplc3F1IHpvlbAfOlrpNvdwDT0SMsretGjA0ofhJVahaj3r40 yuTg6mMQRSG8s+XY9U0fU9LdnaJne9iUxE8JnIAKSLt8VGDBhU0Wn2Tmr1eM84719/d8XO0eTijw no9K/K7SpNL8rCzkBDpPKTUU60OZ/Z5JxWRTlVTLszVdirsVdirsVYf5si0+XzFp6XwDRGB+CsaA vzFPntXbNdqhE5BxdztdEZDFLh52wvzBaWo1X0tPQEMikxRnmQ+/IUXkAdq0BOa7UCIltydtppy4 LkyTRW0eHTILnUZPqskCek8bBzwIYn7NGI5Ahz7nNlppCWMF0WtBGU9Qd/x9zNNIubW602Ce0bnb Op9JyCKqCQDQ775nR5OEUZkkOxV2KuxV2KuxV2KuxV2Kpfqd7Z28couLgQMY2MQ5UdiFNeCgMzEe AU/LK+EEm0TmIjcsEj8w29zbAw30smpkgLapdXJjZQw5NVY1ZT9r9kqOpNMpySiOXNu7PjLMLI9G /qHL5muvRk/l7W9JuLZIBfo+pFyslpJOXlVhTkiiRY3YKO/HxxE4SHS2/PpZ4zdHg76/tDJMynDd irsVdirsVdirsVYD+byk6XYttRJWZtx040yjNMCgerh62BMbHRjFhcarJrZE8Ea+XCitbyxbXB+G ImoLFQDzcL8P7O/avBTx4Y0JGRyCXr91m689h8/llY55TkOw8KvT39P2/L5yiC/mtob1NNaPYwtG atwBZkWUr6ilthXiGHtXvmy02fgx5PDOw4SK5Wef1UavbfkO9vILOoQAmwpU512Lk1lfliHYq7FX Yq7FWBfmC6pruku5CqtCzHoAJBU5p+0xuPc7vswfu5/johvL91r02p30erafHFZxOU05435tOC8o VmVXLL8HpbeNf9VdXGOMGNeq+nnW32uDhyZ5SmJxEYg+k3zFnfy9NfjYHM62E6m2njD25uUWNGAk AEj8V6cvvrmZjybVHYcdfBlMdT3MotLeG2to4IV4xRjiijsM3uMekOCeark0OxV2KuxV2KuxV2Ku xV2Ksb81xUeO7ayiu4baOQytMY1SNSBVi0hAAoprkBzLj6kbA1dWxPTr/wAlvHL6/wCjBOS7II3s 3KRqtdiH7KCW+/MbJCydnJ0GvhDGIjJGPPbi/UmegWdrd6pbarY28E1tHI6fX4fTagCFAOaO1diF ymGOXFdbb/c7KWshkxERnxA+e3NnubJ1jsVdirsVdirsVdirCvzS8qah5j0iC3sConidiCx2AdeJ O1Og6Zh6vGZGNdCpjYprSPKs1vYWFoUm+u2q2qXUxuI446emPUmh4pLIeLqVUOq1Pem+a89h4ZTM +KYkTxbEc/kmEiIiPcF3mny1Z22ihbaokZ41Yv8AGXKyrKhNaKCPT7D9WOo0GLBiIgK4iInc72aZ VxbHy+wsxh+wM3GLkxK/LEOxV2KuxV2Ksb85aBbaulsvri3vV5i3LCqvUVKtTcCoG/bwzA1uITrv c/Q6o4idriUO1rrv6Skt7bTgNNip8d3eCL6wWPxMiQRXDBUoK8+JNR0oaxh2djA5yI7r2+xp/MEn eh50i9SstOivLNY12klUsoJYc4JFZe5oQxyrU4IYuERFXJMJmYPFvsyBfsjNnDkHGLeTQ7FXYq7F XYq7FXYq7FXYqhbucW8VzMeHwRg/vXEaE70DOagA5GIskLKQAssUsRqyWD295LbHXJ5JX0shIQ8k Bj3XiQ9Qtdj32rtUGgQEdpEcXuDHHIDnujvJs1yulz6de3EEt9ZTkSRwcQyJI/JBKqfCGryGwHyx x7RIuysJWyfMlk7FXYq7FXYq7FXYql+s6rYadAhuriO3eYlLdpahC4Ut8R7Db/M5RqL4dvq6e/z8 kGcY/UQEofzHo0hV/wBLWkFwFAfjJFIvfozAE0qcgOOu5gNTi/nD5oK61zTWlWuoWV3Hy9Rw88UQ LgcQWCoeRoAATglCUvqSNVi/nD5sq0y8gvLKOeCRJUb9qJg6chswDClaHMjGKDISEhYNhFZNLsVd irsVdirHPN8ttEsUv1uK2vU4mIStSqchz4ryXenQ9vfpmJqSARZcnBjnLkCUJZ+bNOuV4TX0drLQ hyxiZW6DcnuQPllI1P8ASbZaOY/hKw6xp9vc84ru2uVBYq8l4q7ueT0XiQKnwweJE85L+WyfzT8m W208M8CTQuskTiqOpqCPYjM/GbiHDnEg0eapk2LsVdirsVdirsVdirsVdiqV65az3Nu8EcLTLNQP xk9KgU13O/IHuMqPUEbFNWEtNprSy2kqWDO1rHwUveEE0FN/3bde5riSCQSNwilfR9JurS5lleJh 9Z+KUvO03Eq1VAqi15eOQ4QLIG58kgeaf5kIdirsVdirsVdirsVYd+Zeiapq1hZx6fbm4eOVmdQV FAVp+0Ri4GvwynECIvdK/qF9Fp1tZv5dSeSGGOsv1SNiXTZgzeuhYnv2PjmBLNqATWONf1z/AMQ5 GPRwMACRdDnH/jyD1Ty/e3lldQ2uhpBdOytGy24hOznlwb1mCgAb7dKZLFlzmVShER/rE/ZwD72j VaGPAeCjL+rX6WY+RNOvdO8tW9pexGG4RpC0ZIJHJyRuCR0zNbNHjMMYB5sgxcp2KuxV2KuxVg35 haDq2pXlpJZW7TRxRsJCpXY8q9CRXNdrcM5kcIdx2bqYY4y4jTUqXLPE6eXYy0bClbNRtSh6Sb7d NsxwNR1x4/mf+Jahnjv65/NLdf0jUtSjRbbRBbTBwQ0cKxFlCU+JvUIFPDIzxZ51cID3E/qDk6XV wgd5SI82c+WbW4tNBsra4T05oowsiGhoanwza6eJjAA83V6uYllkRyJTPLnHdirsVdirsVdirsVd irsVdirsVdirsVdirsVdirsVdirsVUL27gs7Z7mc8YohVz4DpirzDVrvUDq9/qM96LrSxGXgs5DI lOJDUbhRQOKnf+Oa7tOjgltfLv8A5w7iPvZXQVYNZsF1me3F7c2dwsksbT3ErGGM8yBVRK3ei1pm eGiWpx8uIPStPYNY27CX6wDGh9fpzqo+P/Zdck2A2LCvil2KuxV2KuxVJ/NV3HbaUxlleJJGEZeN JXbepp+5V2WtPtZCZIDZijxH8fpYbp2paX+kYmtr03DLwUxSPcKw53CQl/Tm+NeLMCh25bfsmuYu S/STysd7fIxANc+XRZ5euVvblorW9ubKZEIae7mPFmqvFUUzNXky16dKjvmQMke8fNrlhydx+T0x AQgBPIgbnx+7LWhvFXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FUHq2nQahZtbTAE HdSakBh0rQjFBYEPJt3aS3P6RktXiuA0cEYIVpOUicvhbZv3YK07V8MwtfjOTEYg0TX3gtenxZTI 8VGPu+9bpOkarr/qapbXdrHBcs37qaxWOdAX5FpEdS3qfM8fbvl0Jce4LlZNNjgSJRBPe9B0q3mt tMtLad1kmghjjlkRQisyKFZgoAABI6Ze0gUisUuxV2KuxV2KrXCsOLAFSKEHcEHFWJ6to/lTQ4je WunwR3UI9do4UVp2jhIm+CPqxDxKRQdQKb5j6g7DyNt+HHxcxt+l3lXT72aNNQk1Jbi2k4yJCLaO NtwQQ5YF1PTYEUyePhIsIy8cTRLLh0y1pdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdir sVdirH/OPmS20Wyj9R5YpbklYZYo0l48KFqq7IOhpgN9GjPqI4gCerGD5k0vVNMjlvLPUNUksne4 guxAsaJJEAeTCGQKQnJSa5CcBIb80Ye1BGzESrrsvtvNWm6DIq3el3likjSyhfRCB5ZG5OwDMO7k nfqchjxGJZajtSPIiQ94/azHy9rtnren/XbRZFiDtGRKAGqtD2LDvl6cOYZI8QTPFtdirsVdirsV Y95s12GwENv9daxuJTzWRYPXqgqCvEkAGuY+bURhsXK0+llksgWB50l959WuVt7uezvbrVLQMkF0 9rOgAc0f92nw/YanTK8kxLfhlfuLbihOO3FHhP8ASi7TNV03RbMCSzubSyt41jiH1eZY0WtOrKKd gMjDKICyD8izyaeeQ0DEn3hlOn3sF7ZQ3cBJhmXkhIoafLMyExIWHAyYzCRieYRGSYOxV2KuxV2K uxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KsF/NKxku49JVVZkE7LLwFSqsFq1d6UplGpyGGOUhz jEn5BwNbi4zAdOJis9/qGn/o02sVqqXFuq3yXMEbfVvTbiObQoxY7/GRXlUZqNL2uJXxkHl9IPeR vZ7qPxXLgMAOHax/FX6ArwNc6zpepXF4IoXWMJEkVqFLrFUo0XwMfjZgPhoaZusc+KIkOotxTGU4 y4q+A7u7ZmH5Y201v5Y4yoyO08jFGBUjoOh+WTDmdnxIx797LcLmuxV2KuxV2KsD/MC3mk1rT3jh eb0YZHCIENWWrIv70GP4mWnx7Zq9f9QLt9Dk4MMyNz3d/wByWaxqGtWupLbW8tqLAWySPcywRbOx P7qiRNWvQbdjlHiyrmPkO78BuwxjI7xl/pv+PX5oS6e6vNBMksCi5l4iONLWJJKKVqD6cXJR1p8Q 28cE7Md+fuH6nJx8Mcmx2/rH9Jeh+UlZPLenq4KssQDKRQggnrm10392HR603ll703y9xXYq7FXY q7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FVOaBJqrIA0bI0bowBBD0qCDt2xVSk0+3lKeqPU EZVlDhW3Vg4NSK/bVW+YGKsevfy/s7rVlv8A67Mkb0N5bcYiJ2rVizlOSc6CvCntTFEgCKLJLOzg s4Ft4FCQRKqQxitFRECKu/gFxUBWxS7FXYq7FXYqoT2cc5kEoDI4joKAkNGxdWFa7q1CD2IwVuyv ZRl0m3kkSVmb14gRBMQheNuBQOpZT8Sh3pWv2m7HGkWkcX5ceXodVOqRGaO79Zp0dWReDO3JgtEr xJrXfucK2yaGMxoVJrVnb/gmLfxwAUsja/Ch2KuxV2KuxV2KuxV2KuxV2KuxV2Kv/9k= xmp.iid:0680117407206811822ABB70E04BE29D xmp.did:0680117407206811822ABB70E04BE29D uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:a3dd3c09-f36b-ce47-a9bf-cf398dcbbdb1 xmp.did:C693614F1020681183D1DD485FE66904 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:C693614F1020681183D1DD485FE66904 2020-06-02T15:26:11+09:00 Adobe Illustrator CS6 (Macintosh) / saved xmp.iid:0680117407206811822ABB70E04BE29D 2020-06-09T09:50:59+09:00 Adobe Illustrator CS6 (Macintosh) / EmbedByReference /Users/admin/Desktop/비오비타 팜플렛/수정/내지원고2.jpg EmbedByReference /Users/admin/Desktop/비오비타 팜플렛/수정/수정2/표지2.jpg EmbedByReference /Users/admin/Desktop/비오비타 팜플렛/수정/내지원고1.jpg EmbedByReference /Users/admin/Desktop/비오비타 팜플렛/수정/수정2/표지1.jpg Print Adobe PDF library 10.01 }ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw $}ICC_PROFILE{od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B}ICC_PROFILE3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQ}ICC_PROFILEDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKl}ICC_PROFILELnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 }ICC_PROFILE E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ }ICC_PROFILE K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:}ICC_PROFILE 7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_ki}ICC_PROFILE kvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht}ICC_PROFILE ! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: }ICC_PROFILEuGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhw}ICC_PROFILEgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=}ICC_PROFILEN=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dh}ICC_PROFILEjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<}ICC_PROFILE|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~}ICC_PROFILE !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$l٠6vMbd5ֲSxdaa.F=<|қVMhlm2N"u}4ƊZrSWP}<j4CBV8Mqw& w i}QՑ]58h*V(wfC>VK,l.J7lr@OWL W+fGwNjir͙|v]J[q[@+ OOO# -7!nf5f t1Q$x[s&2;S'r_憆ۇc"Y,Wy+vQG? ~f8088rxcbm-]9N'̔E9EZB(Qi_n GU4)b/n$,@. GNT#JԼpi+=;178+̖< `iO#no%Z9;(2[^pإ{QC[C%!Euw%vHl yugc<%jb- #u h$aG7ח6~bf6ǥ2-/= ϰycL~Y3; d9 &֬q;9{M .-qktS+6bm,lp뎻{(f6?W{- IͬCVEܖJ]A}hi[Gg3Mlu#JgK4Uh)EZjLMK/-)1< ZN rY^+/id%hW ucOc1fKm? 1Ooq1Ð:JIp 4Lh8l29Kd<'.7I|sySVEeg!+_Ies:,7]76;=s !j^h^C[hc['_Yw ywa{[GO.FY\4n)953V6ћ+k{aoPƾ[$qE{JT?#qicle+LqXy2\Ch 5.~SfsS߶9a|a ȟ;˝2(@}jL1w6({\!~:H|v^޻̅b~6{V\Cq'Cj$s]le׷/dk%så bl-d82!{~^˒7$9:Iުƒ8кB*x.CY369,&ܰgiBVor /+."sndvlGʘbqOP Vj} :f [-2{[FX:KFֵ` $I]ϫvQ].Lͺn1w O?kdSO?IZF>%A>嚀I*qwai~ l19\hRK ]¾lb7@v8{浖C oF" <$. uD_K=#tM? -}Ik+wpsg4z3_LVv7%o,eyVÕ GDk._| uPIEm=m :]]bl%,L38Chor6v8,`dA ~hK/o@.q?|+>X彿 tRaF֊}.pX9l'"/kx}[=di VYkC_%r1s*Cp(2YHkC]bG!G82C*=URBq,wCL:f3=d @[>k$mΪpy ?,vv$cuk=1Ey,ξ\OU[o82<ͯ=yttby6ݡMZR!6crhMvbt͉Zfj'sYdUkJEYx֕Tonˎl$L6,6ʶfH{M`E~=:;,wLqFK@" ^`6"Sdkq$C"#u{MiAi:+pKk\/.m,T@+-E;{H_,37xi)@=KuLtI#np.a&8*% W7rmۭ"sLf+x$1XVinax 4pEcWdv||tK$b:qJ llmUS'nG)_u{7Y0+Ky+>I_%ڸ|q)IpBl7E 1R0|1̌"RG޻f=XG(JZd4< s#6aAQ0-j6uVqJ6+>BK*޺hV$y1?-#qL^ X3/~E$mzA,siǘ^HKumBJ!tOg1o ׂom,YKn!1<p+U[<5yld>+dIzj9%ܯc;]<%Y3j^M8W, èޓ1t9[Ymcxyo'sS1և$m:"iς /` 3'l6G]rη4AUW\mc|asZe]t#mD#Dh>=BP?<-Ca1R=\Wft ājʵ)s'laꐻд HQzΜ \GR. p-oX.t[KCOkqst 1>^<{h>hVӆY幞1lkO." ")! Bknȟ4 <Ɩ˅)EAжkNNy<3V4H,R iNzlؽιtB|Ǽ0[EqV._#l8!*bh|!հI\t$doAORUd%=A9q[$sz )ʅ@xup :?aZ[k%G:2 ci{P/x4y Ym $W!ӃGW.+qI.#\uYh{m,cak4u!8!2n@0ސ\9sSIhHHEPކ=M(Z>G#֮]gu;VA45ჩғ$`Fd (9TAt]TZu ]W0xWQto[e ipkX=bq :ySx#epkΧ4HdWJ,cZƚPWBz(>I\ك{F,wK88!7>*[MϛN9t8655B˽yﯞAaA*i`DNwWPs(濓z8Z󪒇ĚΊ9sV^T)xJ%'ypUζkNk)*H4jD,wʘ DC5ཞg x)kǑkFYghx.gΕ4ȭSS\}i9p殠{dms,,%p1HyƇǚ{D?o:]Ob.zaN-E s=C@8p..k@P^_uӅ8p K->\#,CJ]It=DPPV6#[(<[S tP׈ F@!T{eS/TR4UGg򄭄xU/h=Map-,s< PAEAbgkLDƁJ.{:NUDTҮ8q p. jK8 4VE;WS>yjX䖷NdVӾVd,hwq,{O颔<-iBH+T3(ZgO6LƂ\iƞbLG/9pl$}T6C)顈=ck(K]4 Rp<\Q8umG"^xi6KxO$i|X@kxG_ d/ys{|GCIh55%0, }A`<u ^ uP*Ѿu b|sأc\ 1Ws_#09̩ sB딽4:?e$wSH#O*& qO_W0=3k[Ic4SF˙;h0A'#BG9*[쳤>7jUfH.i,pczY#du5RO4ckL\08RAVw7u2CAqA.-G:*u8V< GHO[io0Ƅ5PKI2:i @Gnc\Kc N~4TzV5ǘ{GQiSDz+ :54Rj֞tqsOAW@^'T&2=46Ndk86^^Wa5w(s@4]+CAOXk_w]:Ll#١_#|E|--21HaEs -zZ(x\Ծ2<:\H\hmqH @MOPB6>X&N<^gqpgd{ H$ZWV'QacNj p&&xWVokÉs ]xqZq+FP!.½&?hsCGFis#/c@H4_U&i"isƚt3Es543$up5#8_d9 )ZVMNHwiV;sx+NZEʩPLJ5 i;V}* J!\6I N @@W98T+ASA̞<AĪGxxBM+JV>+=1j}?T_KȟW=?E>|9.PkzS9zOy<>_]d_Dr""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""DG-|ѼMJJEm*A^w/cv%t'4Fӷleӌ7%XZ䧻 o6q%UO[w;նWo+cu<17YC ͵v<%$n)n20X^3+ZΖI'e=`uƽ\]Yt:3W. 9H.fVQcݶj >Owֶr㙫6wIӹ+qq"\,t_Z2yqOyd&p-rr؇4PFY}'Pb_^6 [X<ˋkYo#@]b88ނ idӚ/a^i4.e͆'PikۆfL^bѭ{#"tk(8Q\c.bIM6+orwv^mes?ϞLFeyouϑr#@ KaYNy8Me!wj"c-z%[7%x+,f |w0 )>_iwY3s.$VÍOz*=\H,>?țlh\[w}}h؝-Q4aݺèd^ham1s]c~l2&\KD64fG9&>(EExqjWvoeg$2]{cosso-yTvN|usɸ Kq[b>8M{mk&Й$>#'SIq. QGe:tIXO7llrH:+% f>kٞ2+Fap^\nziS>Хg;M~ at#G4V`L{{3y#)s˞M 2GJJEhef֖toVy!.u)X{cfeW9Iq\6mӉ},9qݍ˜࢒yrPcΞ2o>;$wQ$*SOb2)5ݿ8iv|Вv%-$ܓ \.}mvY92XmnFH 4Y[ VtN,y r6斿Zcf eG3c$da42V\6Y+yq^6R`oX50Z{Vb0fTٜICM +#}K\ǂuXyo1*Y^dv2KuGl# ?WN28Y㢒Xd26x2:-mknicL|A7yG>;̶ND,gu'1)%W,#\dW#98w9Ll}FⰦkpRO^'֑<X]C ||O;1q '_u}ˀ5hVр]k1om{e ӳf7tV2ә3&ѸF[v(E'dF2Ks\*ZjmvV!m>j#262Ẏ{غm9Wx6.I#~+4wMio[E-sGHqhWN2p̘Ydhlvm{z&Ma̹~KwHCYlaZpeQ.lMKpWNl̶F#E+;GuY29.@U<ՖMlW#q1y6np+1l{ۛ<3vZ_.奸G(|SyV?kɛS!Oab> K%3[CgqsmqN5jr#6?L\>'#y1yrzV+>$_2>Tܟ"G;#x#4kE)}'%8ò2{P7qeNvYG\t@ޣB \6_G_M1ۋαMٳ:Haeہ=qE;r;[h|f|F׸ Y$Id8u;Q5'p4Ul#ucZLw7Lό\]uC'I"$ =]7q;v/m+3\oE-L+w=dalP5̎9R9-'o(,CzhHi+"kSĎ-Ɵ9S䶣ŵkB9U!B?_QXymmr9]nmts:ӤTUcɡKXSt1Œpsd`nIk\ 5NZ"h;䑡@ʰ<N S֣z>ukkLtǼ=H*GKNCΥG2+o3jC\#4PEoY#I:_,NuEG 3&{>h+|h~Ĵ|Qe+^-wmCKꙏ-%k(+ׇ"3maI!w+C(ACC.k_auk׿{-=|PkO\KmE2ݗ2q{1E_0'VY]~.~`^[qVO KN=#.QA-''3L;n&iܦbԲ1C)V@Qq^i 1s$(_罽7Mk: g@VJ#NQ|Ѷa tvq k+qYAKe"-C2ؿ~[p(҄yW:x.j%zfk1.K҇\;J =7W[KI5Qh1GGeTo`.'Uְ}Uih?ԍͬƢ[cm/_s#B.)^J#P6( s-: sZ"Eę^iƄt\7~r5,.m^le/r啐2db Yӌ2heK5_bOh4\<(%1脆V dh/$ԁB+ς2w&_Gum_Z/a8<еƔYCl}зuիm!gD {=q +LcLb3AKdž1ţ$uu s&WnGvyueRd8]'̲Dٌq85]O vXn!yq:v~<}] #KyAys#{<8uQglqw0Se#ӲXÕsml}B˭#"iO^:'se39{Z6 &Z.TOwu,xyLxC#Ŭ >9׺'ildn'F@u296:($Q(0^nu>#&ԥ|;_^#kQk&Xg^"#tAkҧ7A}oOI hp2fz 8yeR7ٚ(a"?.&Z CZNOq!,/6X=o Ihچ|ƙʺ˞/vﳒ&BXb5,xem26B_" k!H qNpl=$tsV}tq,BHLMD Lʇ G൬[nYZ_ fM md(rǞTZ.n.:'2w16*D%#{H^+Xؤm\`>۠FJ$c5jy+#fⱰv'Hz,Q$[|ɞE'[@ǵ@|m2+[rdh x#!sd zI 9+KC+wMi-k8\9@C~#qxHX݌wG>osBmtQpVCHյ4TCZR+fN$p˫E Md-a2ItX㷷[Z.cúBZ[P&`&k: _Vs*>F- sH5RI *XȺZ Z^=5XL |]AԂLө7PV}]A,r1%<@BOZ>Z _2&FC+\ZHp$BGWܵaB:B)oAZu8*jVspf@$B֗1"8ޖlĚ֤gQ}XKjȣC)g365CnI<vd,k#G>-<y&F!|FC"ydkY$oƜT#I ǩÃEnYv^FfW*4H[ y$:Z 4\1:C gH Zj@-xrFJet9я:*u86i(ޗt]*M>~55ϪRM~=9W ] {cik -c@-Sb.gA$HiT#㏞VH%5#dm-p G0E( iS^%&ߑb'WxȣZdVFI = em.oϢ$u\Yz!lu=%kd<[ßN't6y&7<>k OZPM8Val f Idqx|tJ@BָCj*%$t}^˄`/i!ͷx4.8l{k[o-m]CE0#9dKkAUsY>#Kz.] &v6N9%L.V_ƱA5R]#:JVE }^FX\::ϴsR)OI9/"1[k( '浅[ϒ!Fk|6t20q4 r6V3oGpod iOOI$zOODzĪ 8璲BżpH$P68#cg<U9cLJYhuN<KKki_V 4A٫xJcg?oi4}.Cʔ b{K#zH&AF$=iΡRC^Ȍ$= ipH<9T`<}]{`{]nֹdsf4pګUOm<GK#xư87~ZyI10ʭ_^%0A;~{5E=e>>^*@HEohO@jiN_*l2du9CZ%:%- oO/jqP!Hii\nx yqֹןJ\Ii.jHiJHI>4K k4Ԇx9E#FC? \ސEOG)k,y  <<<KP5$@iUz߬9(Cy0r$}L8xl@k1.$?&+T K5!夆UP<Ҿ#B)J p X̭d~aK0կ{IH,d&r\M X woIđVr> @Px@\Cyp<4S\2Yn0خE: \ |aHހS'^#kkGPԞW+)#;@yn`i]  8P>'SO”P}^m::֭Vϸ!{#Z[P08+SCH%lmc[V<@=~c8Ә'r]GJƴG1eGC-h hs[ŠttHi}Gq*0"cYtAqpG>!ʤҽ<8_Wk^3-CKe77qQUW0!w4ب {d\MB,k^GKK]G>:5)O8RqTL#k^+#Kj:hd p8Wc.NcCd5D52[yGSz=:K\o|O4P9qh44xp沐o/#W1s }h0WIT7tCz\kƎiT4 %eMCoݨZz)PCz\pb{hAz>_ʶ4lg̔5H$5¥74?sLnto̤.(!QG5+CLj> R,ods29^NC(H {UY=YEVmybI}!4;4n#.`lFf ~ Qx.m\緥mGI Ċ|y3:Յ "TGs70sx/s'X-h#V4Nu}$t} ThQK^gkWkz\^ Hy WM|H h |+"mn{^دYEѓ^kv ppkKd(êtf9#.8vV4Q8Fڰ;W?Z}Q6-kXh,}Gq"|B:tB'QoKGEa}JᲰB Ck'\zF淁,pJd  i.p`1imqU<ނcuO[H=$֕SDeKxUu 0(W„$<FL\:GC:OSMC+#ִ*n+X8޾`u7= :;HoY-sh@4kˏ?Rc AkpsyM:)+#ָ8%As$P|E*),mCޙ]V\8tI5U1l|nGlc9i3BV0iu]@j>ٲo#[f_62tE'jzOu֚}՚o'[ZK6juqlǿ }:CJYf,28K]Y]1wi1 pw=|"m1Yw,~6Y]o Rbe8eAd󆽅pt~_h[IF+$z yAJE-{cZ%:l7 uYeqe0y'99t& c|HM9k-aزIp ezh"#0IGKwN:ivcv%d$߶>.{RowwYn2Xd9l-=nlITR6إx܏hT^p4CWerzDÇ )mrN!7c=uPzһ顮tqnWə-yY"mXKktƶKI# I@@} sn||oz|rVD'P|x*uGy>o6y]}6Z_!mX9ca8ds9}$PJK2W7,G#2;YѺ8.wmcc5y4[Z{n[{fZhsv2cm,B# 1!x OLyzjh<8Њ8 Oʭ=gZgmX1x,f!ew7;hඵki]#h=5&Xka\>fXβV9fꐒGr -/ͅŊ0u3de8$=Q85>lhzE\͵CVlbzIM;"s)3-]{k{v6x2뻗\]Hm#a"ፗ3|w)eF׹!m)3GN0;dWfq٬gȽ9b z@6iT3L^Y]WSm+X}KRa%f'}ͥ֗DEͳ%1T q[Ժ/7Le9.9{am,VP2Z2o*Gҝ a *#7Y e<[t da1׉mpHnd;^d4w'>cL,KίjLU8f'wC\m-bx)]y= IĠX#Ҵ$<8K5c/&fk;d%|s N6FRR[gھ=둍 &`緤4]I;E0y1X!x3YKMkҺyt1-gYf-wVcⵑcduGX[SN +fK)eeq3.?Yؖc]ml&}BXKuWH!|ܺd-%eî>B5 8jc-.^$a<6 ;w˳6O526%{OxYjkcnܣ'[:P:y0Q+ugrOn.>us7[2"2HiQJ1]㠂H"e͋XKb E |LlusY;,N2 Ŀx{WyWy ;I ?UxƵX5sSO~/DR7 ykչ\B|cYoj\sofh\i.['Ld16:3.f]ݥ-eeV)-,'8WLmi0>`BwO&.]DWq;PEېÁ-}(ji/4݅ԶL|1vrͻ)I[oml6ŧϧWfl]~(˘6Z:l]Ap 6W.ki5sXQd2mN< c<9kf OZCVk}%py~Hu4δݍէLbr2W۶6ޑkۡ^=8qז4|NF m } dhM.un,^ce$q^c7K^FQlb`kcҜEVcn*<[Ϩ2S4qY1;ۀ(:McqkoH azW/1iw3q+)fG<]";LdMjޣ;u''i.lf6Z&7fw;y^}aKeqCvg4}dvծu|vH1noY({ۇH9zFcF+#߶2n#_d"Kyn. V֘e &'mH7HI^Mgs`d2o ~-o%cKlmW];;pZ/zHO{y?1Ó nmn/qM_.L4Xk#8arnY6KY,\myyld(DanZiêiSm.MG9ݞM}{ndiH!b#NstuE%^ٌW+3Wh>Ӑ6jۦH쑧8Z #Ze׻V,dF5͕\yk{.7H2#CESȲ;Fte&'9KATdύ.!/ 4EdJw $,xPz|O\B#d&Iڷ ״(rɤb\\!cqKH<8ԧЬÁl6a.+4xh춹di&< \_uh,2Pۺ:+m%l"@6YzLPV O}ӭENjN"KZߌT]G;۸y+lENuelbX{<ߤj qժ|7]=׏9-KAnly7TK|ok lQ 2H(? IhFxѐ6EooHcoPOQuq8Oz+}ev{,zv6_[m7&. d&_E$d:y_H$[YCh@ ?$66ٛ8,{əkYOnjRf yuK\)V(@imO"jB֐vqYxˌ:<@n. /jG6 wFuœ+:uq%0PC::#hM -F Hˆ$-$mPZh8OʴaG+?ZaJ#shȸEbd.$f>209`>Py,AHEi$ͷ ū? +h-=1oHh9SVY,7 Q3eZc<y.C\qumE]x\s|#z!O.ݷq:&44/b ^X4~l/g4uE+xqCۡ+۩]oa幑d2̌0:Cxq(W_[ _ H)&{Xmv놀$>JԮ6K^m\%lw2=\Gf[C~Tf t8'M mrqqn6fdfT5⋎8\d,,e-msq477lc/,|P]8!gPʧOXsΏё6)&I(ZG;4Tkη0gm6ֶַGsqvۛ1m?x&PRP@E+F y1ܶ+btd-wuYƕˊ_/tp<7x}\9D{wwϖ8cz+^q0K@}@ץ@yңk<>8n&[y"F YoK4Emg9dkbt!.sިL`SL(ZQT 9`9MM08H2z#rt- i-.?<I$zyjH|X yo`8t޷|ⴜHd o!o\{_*Ej E)@.Qs>ӳyk4A92NIjh oTxT?k (8Dkz eXqN`Jh]h.hdh p 94F:}4|T> Z8E*)k~ʅ <  z()JzΊ1ϛ0K3"c 1J ]7[|Bt~czd@J: ̯kz@ Vq 5մ4 &@|9֜>I?"ίhG L=đt\CZ4X djI-kH9h ,8cj%B471ykyEhd84pO+J|-$0=1p{sDB|$,Hg57($${B bqcXkXYH1/N nOS$`kKxt:*siGh$ׇ?kk*}4XKLj Yf23'EBG)?pd[n:K\􊖓UL ? x=BXGWƀπPCJTGI]A*Bo,|6<;..18t If-"pcZ89C$О+GyzC"68Sphh}\O"H5A#?dUUqt`ucB:zc3kGS7*`tpHh(:\fkct},mkY<}MOI$5p>PlVd1J d4a%s_ϥ_ZqsZALo4DzTl$oCD~8:PPNn'N 3F%lql22F7mxk$/ ȖAS9ְ^HVr$44M20X9 P7\8ׂͣ׈4qœ®m {\ [ƑJ~-kZ8xRsLr7MN4  *hq8BEkW:[TjzG*E-2CV9N8ۆ:9hR\>#F\<ǹRǝ9z|5E)DÇ(=#RYoO}>Ua599=KI $J U { -!i7usq8(+xEQb:\Z^G#^8?2ur>* H=oVJh5+Юq=,=O-s81*{tz œ8zE:+HWQyisK,5Cv'kX:Xާqd sƜj.Xd{ZK^ޣOf@ֵssa8 'Ck48Ƥ|>4l, hc\1d-=dPJ# ~os]"PKFzԐtйg[tqhWBQ<<*jHUb5u:šd85Œ5Z Zӏ>E^R#l. 8sA*~} tc9|XZW}4SM1΂]+R[Q^>o,Pc%-U SJWU5uS|ZX] z[@֒0mӇOŒ%HӊK^e@{ OQ4a>y55)@EkZWS(޷ y=Dp14 }]AUٝA-eZևqx?SJ) wAkKj@=28T4Stts$u8TZҮkkA4qcKˤ,NU^[K#I덭coCB M @q-jWP>D^Ƶm OGmIB'2ӟ-d9DZhΏuχ5T:&7FשysHu+*z6ר W㢙 l4 4wB"k`,x%Ƥ38ծ-xmt2`4'p@sCu:p[JдTTFG4V5sGP퉄1ׅoQ< h \$,x!ѴG44VIW䤡'T@4ph[ϐ#Jڅ|R^iKK >=/ã-yLsZI+^tj}^ZAgI.x=A8$ G~o?ϥt.h_[ίWWE\CO"yKz_*꾑WDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDE)Z}딮ޏzr)dDDDDDDDDDDDDDDDDDDDDDDDDQ^>5$'?kĜ* wB-cPZg#kK+se{%voX系{$s䍌sK3XFy;Ηպ[p`ػ4Oy5/6)IQ<9M thn6l%g0Ww7w9ƙl;؞̶,su?ks͛p8L.Jk{د]q}felv6{sLvqfowP[Y$2i<2#lNj՛7 2rPduD-f mc-᝗3'Sρ>Ykm#7GKSggnO'0XY1춷 \@Kj\kMGZpr~LY( 9qY܄N[X; {.rX6S8%6B!l}lR:_[./f]XܗUԣ/-l呖H[ _!0(kux:qX c LgtW_^-R.Fj3Hɣ gKD0'm2[eXtp-c@@+T{ծHg,itfF$h-c@8%iB|+Ǒ&<}CqdS3+l?]auMtIyj˖E )X?Ec5=s}nm)11`6^Zb7kYln}WR OcQ`ۺ! (|2x_̖sCHN PZqVɉݛKi'Z9xvy_f,Μ^rO*7]\6H u,Cx-5坎OYd/nCw3DV2ISx=#ݣ^}Wce0őטXL!y6/m\Ӽ+{l |xH1-Hۻ #5f|%)F[4vkqö P,7\L$0>DU'8cg+<}Gd&C#̬{[{fcex񎇦;K,}I?G$unytgrW6O*KeIywz#}EO1s}j":zGQxCaZHq^MsZ2LNxGqYf-]lMF9}R\n(p3 Lbin`>n -kZ;+ct/.!7-Ӹu1,͵mזk<[:іSaw33p}ַq7<ƁJŮl8eyim#v%d Z>w9ΉUM -qa\[>X]\>= )u&Hj㷿޺x5.ն7`wLoid@@B6 [ +7! H-> <|O*+ QykK)o-R4ZFG,&B\Y[_<~_AZa $r0E$ 9N\;`.-Ẍ3SZelqLtˏˆ;>\03S[}ܖqL%7 l1cm|{yPMtSV; ˤ7;-Z#us}xf#Y}U%Z`뎰#tF1f,u"!ɲԛYh.bpU:,x.?bu~И0`m/{ml(.]P#7R1 8SٮN7#=fڧ#4v00q/n%ۛe,:6}׻wC ca܎x Է'D-k/KⵆܬdW8C6V)4_6O]s3͐tFl4enYy-Kln6SRkNE#Z^uRW[1{^ ydwP"yq9U?}5F,L?R[ho#cRCKXgĂڭg̪\q.{#MzVU .ΛǼuJE\@86cRxU C?^1pdw  Niե[BMyy{!xHO58qt1 IC_U9E]Kqcf_2W8A %z Ik(] z9׉CK5{g0>\@U oSAZMq 6t=1 GDž q$}_ .Zvf[[F<.Xstt!¾%j81yl p O$1A5><zWG ?T+xpy=7Fӭ . e&m(kIJ:Vf'Bx'*/:42LlϹmUthkcpGqsoP.o*7tvBIFhH?;@p}h[m$xn6=}l:r70I|= mCAQE{cu868p d-5T~;Q^bIԶ7 VK]ij;<}x Toft[GLYS::J=jߦj@ p.dsI=O?gOd5e&cZ<i.dVk#dwfy,1G͐I4ZD=Ht=Σ:GTr7 "I,8mtw$ϝJF _7sOK3w ͹վ]A},oK~&jY6D,uN2\Kdx Gh|y1cރhdza 00uZҨ"!홥:l͙ѽ1[ǹ!s&idKd9eit:>P5Bo:oK8[βV1к>.ަqqp6pdu3yn鈐؈{-ua:. >kLGw({=Btb-ke`֞; 0R]Z^ f9+ȩ =&աΑP"㬞i[M 2Wtj[<:K?|cͳ ̍2uєښ4qP-#Y Kgb:+i1.[{s)UefH5I@_Yq@:~b=4Fq=+r8Ga@ @yq\,H0L,hGQۖ.|HhZ$AOAjx[,sHˁY 8O$7I=Hh'Tb m]/kcjhX{\@6-jK1C4w5K]%Z(}"DT >5>5֔X;tq2qY:o[[H:Iz@ZݬvΏ̒R#01yXeF'*[j{$tܼ {eI c\+CN^QÀ@xҕZݳm䌽kF<ك0#q$tZ> T_:I qm;Bg/CZsp2"&7 !:~ 9{_a$qoo\}-wDD5PTW$Py7i?J82) D NCV4XKާ~ kglű.piׇmYG852 r6Âq< p )×];f&*XYHP*mE %{c7wQk[z[ZוBHYm+Z\(s^ս <FʴӀ: ِw!lF평CB׵]\8mqPdKHddyҗHGLm<8uoa," a.cP0C,kI=BP*(*88xz>}gm|p #-|n1Bك3Jű7=۱&IHL,{kiSZă걲7 ^\]qX?CiƔOM}F[1Ih#q.7ԧAHH8Бc𣎜.6F885s ]R[#!ÈOAG*WiNɃJBLC$ǓG3=P颶IYIsA4CڤcMJxdsֹ4']C-Ĩ59N 4;̫k Xǹ6!58LCh8Fܴ12ڲWNY$dN.ekE[ɴT6ӃIb#<^.J~wР\:|h8qAPhJa3[ v2ɝ<6Dfq I)ps3ZE8txS%מ bc,KXK.z:Vy*l`{ 4eP e,=.8!F.z]VK-Їp>%`"{3Mq+'0&5.KhGFzCÃyQls p1>2>q\r@4H?Dp4mhaH=cdsXc1sà &ښ55S2T9'.o 9Vœ8qkH5itcP@VV}v[8QxY4<;r8:Z<TӝG Ν$ճXH$l=>sL%U=@יS6^KVN5,x4: M'+z$$+€ʿ448(1PBeA'ԩu H:PHWhzOSiA4M):h+}/S|M<O0W?O> 2ķc\KÀmk庢tx.%A# j>*k@jI8Bx^\/0/Q19OMOZ6J:@ t9jP xK]+Ik]iŎ}$(kƵApTɍe5:p4 2<t@Ƿ># ĚkPZq 5Pu&,#zhK8żEUY #0saidi>ÇSU`^#㥀g|>h8•<\K^ְp wUk|*lжJO_dR@^U*F5k]Rի-$%=G|xHpWKr0ֱ]\ =BP$h-+Ʊ#XaqIJ!oidA:.mC5Ҝ EyP K;[?#[4puԬY/e7sZC6><>!!i"&8{/uRpQ*,m[,c5atEFGJԎ \(I5iq<h Mj<)N*|C[ZpcHXsO|4u} *] Ml*[@j@憞Ru_dSȠz ]&".kzHh2K\дÈPEEAc=`G"Ja^t4OxҼ  y|EV]$N/-@?BΆQR<*Ok[^޲ 'ToEݼ:#Z7g\q/Gc\*=^|)誤pBZX'/M",oShH<}ɖC{ag hszE:xpN I\z Cp1VԍkChWǁ!Swc>N:8.oDnkOV]M#e243Ǧ(^~G]piŭuAH E':(axai=,kKS5^`ttX!o׊pmO>Tx]SWAXΦי:yK5lXpє= kĊ*ݸH旗k:i-9cV/>`'nc@k]: C*k+d،l6 *Q<VP qQSu:3uOh.# 8qt,̈́OkX󫮋 }.lDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDCro_P< "EW&E>i'OOy' iR5OESbd/Ŭ ,OM}c%]*.,wdN&6$wi{sn,Wk'-Ѷ௥n@_?O}{oqqc2l xc6)^ wv{P= YomΦ#*sKMEcoņW)i,\֔Gk$V |Xes[@.SxtVԺ]4䴎;=i&_uxˆ^iqw<7X\3129lY$ m8Xrn)o2B͍r%;|^|A཰|ج䐺[i嵹gqpϬ42xiR.CN&;̙9gѦqXLVJ#ý]Bn0pKVepcM:ޮӍV|>k!K`dFC˞׼Q4U&]jKP(cgԯzyt., ջ>*ILR2NEf.6WmљXZg,ƾ+7Й"e_&/*f/av$^y\"Rb,qSG{4,i(ozmd푏5.oA@hh*ںǐ'y-]z-c{6]i'naHyYm6XsKFCR^ѭŲ{L_\_4lԒ(bnY6;mˮ0/*+%腌OJ'rQUs%zA¿EGeko1&,3vrs"ZAx8 &Zb}3}f+މ3xLm(݉ٵkx >J{]ut.$d5>[<)sb[ CZ**Sיi|3 6LFf/XF$w#GKGM)op静u;$c3C]u- "[=Cl1L;3?;k,o %xth-K:}6S[y4:9H :U8PTWA^$ Ԟ\W/aΦ4]֚V21gp}sQi;rQW ,]\ |>K9wl4ۛ0M-sÁ`I-Ai ]'ܙ%Ki/W^cZJk*E­.g qTq>z",]'xm&}2?[sy>"қ)pl򶸼gL3[3nmK3ie$-Uۜ1f2[iutN ̸O~!Gynھh 4p݁q4{f=\`.- кVAl&Bں {߭7 w㤺}ۉ1ۖF=r[yw] L͸ɻzC캀㍎ /r}LfZւfWtym{[SZ,>O>[. C"m8w, K1u |BݕSdcPoqKۙ16rWp'q }"&#Zr '!%x,2{~?ےHE+7&.7,ln}f},_;Y((gmq#rwne#m$\t7}Wv:B׸TA{:Z!A4vDŽ~*Lq$rb-sJ9یn-g3@GewwclX]::^ƫkv]vMc35˒#xK}3l-76hmA;dV g[FcA͎>w}̾E֪n-~1h& 4j׺ 5 ud s`ytخ{E^GuD[͔ח,19rU2$ljG@%~)f˺}Q{gerYڲi4OX Fu7@hTkY Owm8 _2]5=k Jr\.LqW8km>fm,1Ka$jAmx g+nv6Ҿ/2_Zmٟi<(gCsT|^H۳ c&c7mum$uִ"x^GȾgXnlƲYm;)۸N <W%q8]K_d`}6|8q3 kR-D,ޱoo<ǁW#}!,4k* Tb\?Z~G/o2Kg̙q:Xn։&T>x<.nŽMeo{`:Ѽ1Ѯo׵iJ,%X{偭f[ w4/,ks*uygZpm/$\KQ86Htp<7!i%mdm&`f%6uXۇ5M(VˋDc tElwuB\jOVvחX'1 L>RxLM I ꘢3ZDt _[/. v=<2;CZZkE2O~&!wm,1`udw/]FGu=˥ֱqH,4ll}pq4W31oVwzK7=ީvىgF^[[KY&v$MW[!76ɤe0(D[ d֗\pk@4+A-Cg1 XHڛ}I8zF^]|L k&3q-muW awIcĶm6בKeFF5mxTGϻk2=h%kG'iutӹ-{p2GKqe$p&gmW2MY-!P-6Qں2+G X&gK#kvY=9s%J"/xX: 18p 9Q ~O'O$|ErGqqܲ9C}uxB*RhiRst=#(4:.om5=KV('|zA\ϏʴÞ_ c1^hC!dcHo%ik$ T>+iuZOkyqy(㧼\lmy%utt5u52 %(2ڠ2G1co}&g%CҺ)-Z[7%ka,dl_)n2 ^ښ 7xx  µ]: ncO-q/9 [Hl۶N69vB[x6.lUQq[3 ;xgͧ&9_Rc=#X!.2:0:>{.TxtWhK=m6XK;~>O ݭgqgWˠ". vlO}dodc|Ak\C $]:h/(qpO"fkA]N?E-v:lŴ6_.E],1hm\ɛ%^8Pޣ_^ 0Xq+pyde+-+ti:,spvg-oS ⱎtRd&6=~kG`/cy%ƍkFZ>\u,E[MGc/Hh G_+ %a)oKN׹45oZGx SyH |bR",ʛ-,#8ԬU.dw< dM`Ix=ч4&RP:VIȆHA0YR(0QasS8qN^-'u8s>$bK@-,eK <׃@(@ q똾&caiqyi\{4.kG9=/ 7C?:溢A}Qlmy3Vv45xdq5!b=<1kE[!1G$说UF[ {oL mQGIZV|8k<D.dEd/_W[|zukQA]d{|0=9]#z hH͍s{Lb760N=p KP@+ZW#JZ-㻊=\:Kȣftt6G3ңVܴ\bׇ֊9,qcĐ3hTTTw#NJoSAi,$NjikWL[bx{qQwB'+!!|GmqsQ,rL< P55S3^?%rA$Ret2N Et=3ď{Czz]XHJ e V m!aym< OΆ]VxR>?|}Jck+{6WWU>4~_K~4]5cT @u TR2Z U\h@!iGTK: lb|8S:w7m]2 ufH4R#3s%=a e>iÈ `{\:ACyz'91H#c 0CBI+Al-`O3؀Y mq=ΥIV VG#4IH#{X泭y#@t`]Pƴy^<Nkh"Ů7etC8F*HoZ헒Ap[=#]b2Y#:s{^](y+6E{LHޱƳّůꠡEѾ79댹Ln#i-,.^JOO ԒH'kG8R72Y%Ws21(9^Q.k@k$zO:jhqxkÚO\Ċ&qQA 4z(9 yP5eosn&#> ڎ-N -wωUS-*8+ yUk1&( Dq|#<<R4 C< N!9{B8{%ƴT`%miL: YZnCَ/dd=!+Ǘ0ƂG Vy+Ly `=ms1uq!*Y͊8!S&u87Z*Y]/"6 o@'8csz[)ƈy)W08$55BY:{lc Etu@c$saa{MzHimCWW")b}CGQ0yPRs54Ð@ |*\N'䇹р}Pp4i:p5toWx=k"5 U s{#%^PA#AR), c{ -w]V8[hks欃31dn2(Kڊj)NJx%U8PA?Z}jA֘],Q৖s'$QTxP~ۀ9-s]2YGx18TH>"<ܒAoKy%0Wb7Tk;!d zCZ95F%Zc :LdWh~iqVUtl9˛,MuzK"#yOc\b 4NGvGPq *}-4/q #=+N"!K>EXi$MMyyȀ8@#F\dMZwPW9s[!yT|0H#w6= P M}j|M\dž@5}*x.'$IdO'ZSO0I\[Du+ cRP~<+♠zOczS=¤ '=11m%uZ3ᆥgHsޚ3/OZH)@hGAŽʧ5:Z Aii+vnx>1doHE'4m$a>eLl $SN${Ii5.ְ%q<:J{clg;lioCA&BO_SA9鑏1Fp\x 4w_R }$ uH"ͱϑkkË+^MO&:8qT [횦{ XƂYG8t5| EV`f$i+Pk^(x9WO}8Qk| Xz#Gxk+WҶG}|Egd5V:'Hɤ{G# /|p.铫"O@T=&QJ iHўYsSwES$É&w\| xF~ 8<+Pk]DpZH4Vxs&Zq rނORu G"kpE]O ) 5s-4 '⩙$ݬk Ncedl=,y0hx-^+^CĴZ+Gg>&Huȅ^z=GUk^=*nƘcu9-i%~4T o, KZʅ^ QH_sc{*ӯUxWbC?[ZӬR+%o8tcK{GXY\E JxuPs=U U\E9+؟ y-W8 ޿!v; zUqȸ_W^Tv2W@9t~]iNCMiO/} }.pDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDP#?!P< >QEEE@`}Y=qoina,0.fY 6JhXŷZ}ͥY-.-% h2JǺHjnen>#q58m/ri܋1vwqozc{_BȉN>@.sgr _>Kxq\y/nmDwM#k-؟)Ye 9Y3#t] p{1ؽ;3NY/(2 ˏ,\ZW9WxWNi]Y]YÌhOe2 wr4{u2ͫdkZq"(. Sad̐Xd}cv|v?s}8Ů8{<7Q|[+;iV*|^d. p_{qmkq,V9 O%0!$1ŠKh01V>ә۩fLսZet4F4 #s(G +Z P Q#ǗVGw^iLfZ޷_xq/&Z1^][r]Z۽cÈ([w,Fpl͕=[Xb'}n"[_,[K<]"YM$Rb"'3@mؾ{ Y:뫝^<\{`FOj)-2بc lvobKc qashI4}I#^pft PnZDjx)noMZE ڲ3+!, [!rL1i_%cpfֶ +"4xŠɟYZuqm6yqK͹cpPvxX;6vdlӽE{WgN7y kMhNgpM1\:ypۗe{ep#q3k3O#N,;s~B6fcx.qT}YFK;i9,ط2H8g՜Üh&YLTo8FZ3r@1v-QLZQVӤ^Szb_jrXo2s?$km-Mqk=@Q⬱m΢\dɶk;'cg41 (m e}ugrsZC|.d'=7Ԣֲ#x2ނ@=*쭰7̺YZfJۉ.0k#tv=[ \i%]FXa0.uU~/cV+ w\[)ed5gI 錤8ciVn+Y@\Ms\G97وmN K 5NlQK%c|^=‚r?<tD6}f+Pnk3,{lEΔ"q6tPIq<-7:kܥYq!zFcECpSf0:]3廥v t#ɭR?R e3fEvI¬uîya02&%StV|1j]ͼrAuo~dGi#~\1W(8*Iq7p#_f?-2w4@E;.{b6̗ʩkX9 *hn3iMbY`w&T^9y܁ysZڳ vf,We..n# \y6A k#nod..sZu7s0؈n)'՘\W$6;3΍h,^qbbK8\Iooaq&sQdI&Kmkl`ȿ̒R0Fʰі+Ŋ߹% G@!bon$L{[JןB ɻlND ,cO]Vx-&Yԑf$a^~; dfR66r@-i#oK\:%.Vme-`dnbOm7˼S~yr,ROgnpKOų ,L{o,1F|/KVŒdfln1sVGgI4ܖ7\]Fw=ɏZ^:X]J m"{l İ=LiY..I i TY(qaku`EᱼsͬVlgiQdf%Ӭ俊Yݗc'45->F2Tjx{E7^!fB!ϣMKImUwG$Üed:(|ϲwDmҧƔ)im(]Ac e$p[cipkn&F:6I4[I4S[:6,|nc&0\6嘌cRZ[c-lyͼe:H.#Cz" &nιAdžRȺ_(Ѷ1V2Yz4%lwYd4׺VLl_Ha ֲ>8㣄>Gu38q9O.Y;gbPEٱ[M c.} 8qۑ{&u5va&;UmW2`4 vzgpt6%wD֜퍒Mu{Ǘ$sT}>U9u r/sO,t_Ekk|=+w%cy1]DW;nLmq kE}j٭n6;Pel,xm$嘋m5חOV\dz3fta%?7sNo=ۭO{Pi?~dG@a.9G0Aue#ol9~꺴WBk>!oeE+P$GQxTQs-G~N/Dm1Ptulmd.<<zѺ6xsdCN+x rҾlest:AE%sO) zAQjH㑭|Gn {^ڗ8 ih_B*˜z, I (S[ˋD++ L\[#usCb$">:ZH\?7*^ۗ rws/էk@\渆@$\Ml'[> |udk^^<8+|5BwaX:H6d灓ۧ۽\B!O%ɐNֿ\P\uSSOZGZ5ފ{\N?>)+bsl/"mױ{`q4QZ!GoN8C!czHw #'~eekcp4i3o&x|0C8 VQjgl:G+CkU#{@>Jә|j/7w/%cgbd/dЛ%رwIL 4ЀkT\/!Er|ilCpz-58==y UZep35&g+/CkqsR78Al L[]t "рh'c D4T$izHIi&M΄OEX_\K"knoz ewI>.⡶mL^D4&ssX66#~<_/Z\^\iӉppyןvxr]Yvc>3_#ZFKx8]ok3L1 kyb'4ꊚIly!#BzKZֹ x.4e?MZX髸G'[8e#_n߭H.. ixX$! L孇TY{Cm-iv̌Zh8z9$7:>"#G@ֈPNi-$bY,lrcKca1IҍQpX0ZN6Fۃd4t?xq9.<ƿo#O*wt}"AWN 7i{s}q9gƽwȜ#, qx"o+nm_ {dtZfZ^fE$c6&LI,-`/%;>",DzH{Eןsz[FΫ]cXN\ -?+<k&FCm-,aq#'H(̜8ϑԳcͫ wiymi6tX0PEkn#f~vp@=Y Qa: z!9ZckK~<҆Zvұ#=\ WaXzs̳ͥ:*$Pcaw>RBW]jYeLo k!%v"ٮqdq%ŗ6o3 tm9ahcs5t8lu- 8|Lxcb29tehi &V,r+3&ttCpM^#\XFO+䵗7\7˒i\67M;z}E[FIN1HS(E@A]VC^X޷ik9|ca!\@kUɺqc 5<6K-pm$XˉA,C[KedTc.ldnX6u^}U{k4Ze䗱0חJ54ύV $rUp&tos^*8 q\XX^d{K'>02>:W'Q(<)Cp$q5Gu:wD\KG?OSIBd{cD}н̭\E+@9:'pOʵ<%FX)tX0CuT\ʫ,Lp} CKCzБΫ]a29ka{2В"RmIm+Ýxjh~v1AuH]\;!YMlnk:f s ECYҌ'EH$8ڽczֶC($%)4m{if1 \{Ok+$mCj$ΚBޮC`ix544V2>XkK<޹ZTuL?ɜ*9)^$AH=41 -,F~t0Or%8"c1J^OAcPih+ M!ta4Ni'͈7ێׅ /=?>m(xsV9lk c{z#ÅKIFfk\qgo'Q C[ê45-Ê$N8B_r@ThQV|}.Z#S˭\Eyc$x_ŝ/Xؚ6Y5q^C.IիhKG:iU7o';n&+(by MZO{&t&+$6Wx45eNXEU퐳 6,y2q4w@kM+AY_M? N.6s`Z&0u2c-kxt8>  {^\n6 sKhi:ON+ ZB~WҤ+UNו8Ӆ>j+앍c%p6 EA W'")Z dIQ]S2:*QYD0p#.!d枮ByRU:=,F̒#BY칀0μ^H@ < ȎcFX$u"|-la-GĬ_L٧۰CmckYPyI>r>^I ltq"m V;Z<9?ʆ&y1F΀G89Zjvru n6>LcD`.Ğdzhұ7X5/s$iP( ?{|hIpwA |I(T9?$p.O:ShmNA`/4>["\Ƶ 16O&i[8 {`"'|m oPN<>VO#DžUkz1lrL |ר Ԟ-~J2ƑCFDcc#cDQѠM*@4• cc]g\je +P( uHϛ@X}>MPTmeR* I=l\+O( :5U}jqƉj|r^_>Z-C0 uV x)ֆ 4 e9ҧpSNcJs Gs } (TpoUZ?hy'!Ơ*">$S {5sjG6 *ip К AT|h4jjFVHy]>i!t̂ad۹2=  st*ֆcaK 443hZ)t`/=NpkEH{$Hc a|"X{1!ȯCI=_ *Z@4l<5R7T ÈA DžzNu pY;{>iN*lGQi>`2^|Ėf6x^ /klh=.4qW)jޚөk}8Q%xo#ps`az8 ]$Iu(^JZ(\ނGK[N|)Ц}KeqF>5-G!Bkra/m|:7Tڵihkz))IoWZ6!ЮclNkAoXw^:@##ZnbB(J<]QQuioPXEpȜm1ǤVYWSR证:jA.άn:C M:$Vk"@At/!s@paT&>t}\:dƊi({Mq@⪈#C^HkOWP&Sb eZtKjCC8ӊGZ )Ǘ@*N9sW>ߕGGGKA{^4uy}B'_#5|*i X,gCDQk4,,o8su|j\}I%1k͍.5֕ÊrO,l}dOl8ו}j/hkz<҅H4WP<x:g[|}kˠQ0> L35u<{@F, +2G❮kDµu !na>*)pi=!7V,kDC^}#HLd= ~[pUu t{9  ChA qU+|xR ڀORn]SG<kGPJqV}ڋur }?msEz]y<=| ?Rg^}G¾wnt\DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDET1 yPQQDDDDDDDDDDDDDDDDDDDDDDDxxx}t*i@}&<qs?[яrbuZa?WM;^Am^r=MoٲXY[e5'+.wI}4?tN`,u.]͎;qm?>]ygX㺍$ mxԐ5֗ۜ 6ȌF -Z[uM }(\?-^`1;,ʞ.l{b-Ό׬FJ:{i6:C!{S$0M5VS,ӹ [jY51̖靽c֚(dTrqV ۿr0kjb:ѝ/tOH?^kt>vY!0:S!g Y_btr%Zemd\ݬev1Ky2 ΅<]Ama-vזɋ\ͷ5-?- sh8nÏ\Ͷ#Z3Vj]1.>ueiyqtYald]E 1 (דBqXjl2HqR>, tSLfuȶW7X]1Y`tyg\=ݍ;I%_1hhПd;.MhM9{[iu.fP7+w}g!ܺ{p<p$4/s60Xk>};&w2C'޿ͷt=m_gsQdufIfou~<:v\B;A poX@(KM)խJz©49-nav? rw/;/!u>-rw:ŖO-Ҳ,UdmoMţ;MQF?eŶplcGUc`fȌ7$%{\ܑqmL-[am%Px l&QZ<=H.NjE~+}6\MkK=վCo#Yvw:$0X˜<Đniy5flo#uvQyA^ `oi'Si Pw,: eѾԘ~AqHd97Ofm=1tDP.4%=.s4, [f[Ztikpٜ̲[V[u&YzYwXH& {YY!ƽYFtXp<6.skh'~;`."VJֆ 5l@o[cHN uƀ4:57h>r5n3Em+tNAs [2:v闙EomKbXHe[1i;]{"7=ii32KoJ XZҖ2%n{o5Ŷ%.mRRj k~:X[EYXk4osX+~1ae VG#j+ʚ_Ybry[nccbM-C0vl* |4)GVۂ0ֹ+c&1SCSٱ_cѮ1(`p>h\j 7݃֍oB;k4mXX 7Xs7cyoS2厡ɷY=XG-$Xn/-Fsu{qAK8al@644rݖSJtb`Z[%7!ut؋|~=S-`1Fnyac\iw㬬6]Goe"qd/bq[W\Zp<7ۻ _w;su i2SClarVj |%!ts{}1b)A„[X;}Q~&CFˆ]F"ΆFLlZN+N_1p:r@䙑^2|n#H%1Ӹsk0w[yf"[\ublOyUuζ\2v˻b|e&IjyEjIm1Xg| 9䷷kf\>4ڮU\Rܷ-˰I"_?ˉSV968:[{7el5ne{g#YPQ=9aC1=K6l.\Y7%;Q1Xy}.Z8NoFkn1]69coP$֪G$ --p'Zb 2ƾ;Qok[I^ [+vdYcu-r=a0ot6y\O`1%-卆:5{վ.3m䲳7;̐U•WN+(,}> 2Aldki^O[_`ᙕ̘"m1.y?\dC;̸V4IY[b2RdŸxLe̸\uw@|{OæaNimE{6|uw\ I>bSpfZ$h /U~#N#yw %o%l}Ntm熆 W(aYŜ4rQOe.<#xq=$-xXMkndd I~I! z pc8^8Kx1N\c4nn U{e"6EX$8Ym`W>ҙ8FybrS;mo_Sc̊ca_H\&dn>WRaMiael}-yͦ7.%k;;5Nf5=tsɌI$ =6Iݡl]ÖEn>,8;5XURYՆZQ[Y1vd纸Ki-$;`#z-f-cσIꡭ=T}!]؞}mΆZnz-aj1W;l/^ܶgh\\S>hpK(3HnaҺSs[[Lff9q=cnk:hMfv{[=պ;i4q{C)-.[ӗomUe/!mߜ廰dfyGg:8M^^#cY˙>~yywi5N3ECvRScG}i_G$19OVW:OZmfMd鬌ѱ͎<0@B:.mof9lrlvsi5>GˆcqۅlxTOX/m Z+%&--ƅZA3I5kCxq>m~|9=Ԏ5ϗȐK :< kxq4/p-&%E(6k~ZC~:G9q245uu8NJ-G/>eHPkZEufXk\gC!}z hjHf/k2HC P<Q {i]Kc,tOt3;!{<0 hsrqtЎ><-yi.j\m[<˫sٕՕØ6A-X>5E[&*ecnOĜzK.mf nn"hcgPp{:@ 8.l]kV첶0-N|J•OqyQMyaK dQo8z˙FS g#6:뙥du&*C(k>[-/7.:ѹk -{Ì.]COH/Ht=%k;#%HG>_.;Fm'?[2 #M}ϑf<1ed0t(QqAgsbxʈ@{r=Ѽ5#TFPΞ_J<|M9]vi VSVO汵-aŶv"t&5G..YYc`.\]؃*xr <@Z }{ȯļcQB`>mMu%SSdcxvBYfsNhkHAz+7IkMx련 efq;e3m ͐]dl0WB.8Z\ZSRsz<]A.Z>ef$7Hh h@}QU_52W +N"h <8[A{i&81{mRF1ӂg8Oi@[)3\0 䴎~.v@dk~qF~B.7_x]֖m+kI2Y;2#jEjh66Vm!\R#$x =멨syܴc!ov'vLYb&I>CI.ojX)^m04ƚ7!92![N@d̝сk\Z:zC+A}}Ӹ &Y$wrXF^.d(Z+帼qs]~eXjV"I@.1'^<5ͭĢ'ekIkO(|(iI'W,:GM_jH p_t d2Y {n %}4lOd4i*ps6/SвZ a"QJcKKǀ!Cμ RµM|V;)YGW^OnКԚylO$SJրX|eӹGƁypE*WV! \C\yD|+!gS5kÍAGGqm̹;pq,*x NZS|zA>V.Ψlqsn"il$ChI<-f^"3pw_~{y#ƜVp❱Juz^ 3]#kyƜSQJRȎ p!Ρ@>K >,>Sn#9=v5x9%HPۗ4F-+:eçAzZk%k#VB;"aXߥE)Š ZVxqZJV`﫹_0O8!>dd`=._H`xsd$TyEkgˉDE:#.e Aք ʀb I\I-IJ!s_ҾپcGGK ĬlFy4lrE3 XC[Phr]NƺNtQY/tS0YC+C¦Ky PpB][]"(wDSyÏ$RD:3ldmC= a2OY GEbɟ;,nE8M ODtQ54'<~K1Jk{T;>^*9%gocDO-pZ4tPy+hcs1Vy\cJ }V8c+MLs ZG։(i5xGMh@żˏlҚJ {CN\5IqkatLm>Cn2Kq{Qe`B׭jk c-͸.F5Zָ S*.#0気u;eBva{#1]2I GQ՛  ^ac!{ȷl̑O |ud YHՑȚ}Vlm/sG jZ}pT"x`ku,DkoJ-,07-UlMsŏ{C;@\XK8)) f!Kt4wD 9)T$ң:)JD- Y[$h#X״x0Pq"c{-wT~[0D1E|sac(.db_14[ȞTQĐ ssExZvee26FsFBiJq,A6.yP|<ұ/{6Bi&"cMx֤Ts(W^J`c/3I01mLElQ#8FިPآ+̅B)w"YZ[!,ln!ABB)@hEqfs'2}c>8[.(O>Pjǵ-6ж8CHg{_shxpV2O_ d_V&ˀ$NOxBpo+@K}:(dp]J khK?<1Ʌ:G8GN=.{k^@6H`A!0ځC#y>5M!%ϟ),{mĂ0;:IEE:qf-ąd -5kP[ 1 xsd&7TtB :x#xCjh$sG$t drxap"3q e`|@e.\үh>] uwrZ8_s#^䕮qw&O*Ek=4>ȥM\CR@u(()zk\c;bal (/3keZxJ05qK}Nm@xbDB$s氿`P WMOKz¤ Zl{pm*Y)OH$62M<oP t2CUL6\RRuxp<}|)^|9) ZΧ;jFH'Gyks0XZ= ~괙8q8tHOn+Cro.gJ8& {Ok x=Π?/tdsKeÃK ׵ć Z:1 .xk?Iu9*)ǁN T CZ(hsG.5ƹ\/ƝFORU:4 ׃CR~W6Ҿ@ DIṈiU])8HloP<55j>LH&{t fiÈ8sP4!OJ.oSkkI\4Nކ lhK]δHc*hFD58 hG1^5WOJ:p :R*<X}Cdkahc\ΗC[\0QX`d͔l4ap><\9UUqkx@ hxT󢘴Ǐ>- h[K, [c!WH628kHk\xzĐLk-ckEdF"*7̍y=,is@hk&P8S@ƽ#8I#es} X⌵cZIƍ n2Bc;^d-t=M>o2U-,-@L g!GՉ..wX#wĂyzκ5pxaaa<^Hk:p>ۚG#fQ`psIGp९k<$x8[BWFaǬI<((^9PoH*y-w5|mlNhk\jOA$*(ިKJ:C#̯KIhӗ]O kH.K|ή=*N="ȀhM xT׀&6pA i{ A-)ɾ s}tzH&IJJxpqk QE.4<}hMj'OPUVV81E5.K·1وC΄h/OC|Ζ68]ZU==n.*AWXC@{]P;k8  jf;%9k5c8uΩPf-.eޘZy;Cēq@tTkPޮq_kE` 555{ICOSEuPZye!kֹ.  0ؼǀưUK]†ƊJ TPH#GE3G- gSa{jp@EMh-tRIye9` q=1<{ևSc$Jf i,y{A < kUV VkQIN֐Iq-"W9c];pQyNS:y~._Ȫq?J=]_O/Owk=#e/񭂮)-~1qu}/>u@|?pPQQDDDDDDDDDDDDDDDDDDDDDDD8H44O)< +Pi?q,Ѳ9uxbxE9‚'L:D^Sh%u纽k%Mkd5OO_[l-pqZC+\.kИA,ܮ)car9/~&0k"5&YE sqhmi,`uF 6ٓ2iXk\ŕğQ{$ 59{,=^52 ܭ:[l51B.&@^:H}/K}ҷqKd!dfu|^(me -p,uWMխՅ͍͕]Yk[whdik@sH =K9MK7~62ֲژO\.wfOZLV16p8 1c2Eo;# `-<1k\Ly{|\dǛo- -5-k^ o*hˇ=<&Kt'Ri[M_k g{JJj,gԒ={;;kKSc:ICzI*|~!}^!>;!G:V0Uuz\1.M', Άa,rxJ`-[+ &9l{.VSh?u$}_IV鲹MdڛCe<5ΣOmbqV\}9cn!ḋ1MPUm,ⷲP-{^ڱqkB \c j, /g9FgZKYrd'h1-l9%qO^e- oP/;[c Y6OTf*1{x̃osXf1g6fַ+xOl}m{./-\*'h3>hYt;k.&pbfkD\#639m4t,.)mclFL4Cw.\\гҗ 9-{C#+5gm\'bX# *Pz/%>1>bK=Ac"pZaZE+}5>$]ekM1g\m.XaXq,Cʍ+1;q؉$| ̖N􍝍d5}[\U:Fy0)jb2s:#mf69D9mngykZ^G:ڤM[{fa ZȘKʑR-5%e'*F(NE),NF y;kl k, MPTv/NOVc3ݣ]/tܱKRך:>w5Y!-9Lj 8ܼK{$hԚ:Mw}{X;6Gat/i3'`q8Ane 'F~cn4Xc]}?sI`8;SۖBqws:I##X\Hn"3Octt6pXO+jImk-s`18.&|Wn^3+1cc𗹹"9%_6GIyB E 42NLM9;<p[K=7>ZշLŶXN:tZ۵psa{$>P[_;qZcW7CMpx|VO.>+esuV*KK.0ێFO$5ɸR 69Xf㯭rYxZ]}n=BGyKA[2G{s<@ms-x,7vG,>)cIz8r;[G *(n;r6~M=sy /#Sʣu Y637g\tg۽ԕ;rͷL>wL]g)4[âwA$y!c(Xσƻ [Ck8DYe&s;A]\n_Yk[ʫJ2lc$}b;lFHF{hl4_KO/srYc gjMrki,q HDZ7eInV&Scce]DÅis[cme=/}5@;4mӘ)rl m{o$|6WeÏlacl.+)["! dnm ]r}8.h mKka.lWRPKs'~6>CWhzU{K .r+'.鎬@Sa?1.&w W ű+ۨe}F:GN^K=-B2L[)DrfڶE0K%XFx苄2$ptܲwŔ[23dm=YF"%Ls.I6R3%wM&Elqk,֚ua";F>K6!&' „ d7O=1Iաcea78;8up,+rq==o&эF?YId0K%EYrnms#!amŻX,Yh s.+WP^ji:{ e1I6vWclAc]qu Q}r{+fr2e/'kio #Dj/Vz [.^1X:nLm-;$NOzUF^G\ `k,o-{V2H iGPdݫ܎S1$[a_bq9W؆ l_;cO1J0.hQ3:;K8ogᷚuh R]fnonm1O~;MHne>7A3#2uąo̫)-qڦ U] acܺb~:^dwikm%[o(o#A2'Z>ayLn'*moUGh<:sX.s]]9#ΊEm-5m[mSig!6QPKdYZfWH1Hy{חt׉๊?OY\ۉXi\CN^Ao10]UIVE/|PJ ^[>]TRz#Ygn`t,x9F-!1g{eq\]5Xwnhs.: 1MRD$&' #^dzj W^f>?"s,uG3)1xgoV; s0.i0rhm02f.s7ڊ{WZOk긧1b8'tA\=h {1l56AӺv٥x \K {wZaPL>6m`Qkp͜29dψL5#zzϸח@LԂ  wUW?gξ &d< ^Y-薎dqsEx8zIjZuե`;ID< I4,c3SٿK5ud\9wynql*xRL˘!ŝ/jNF(+Jq܅\^G`%Hkq>@jy]C>*ryFS0[GGޖRjλ6W ˳ &ޏd|;`Zdff p,Wcu5G73*}5\[?:#c#et2y:8"j.[x?؄F$gHz0zi^U=,^ɩ/>f2i s^s"=xsJ?!P29B[(љӞ leXe}^;y[˒d5}ť/s]+#cX,]cel] |E3GZAPV;0=Gj$cW5PT涁d`k#{]!Ӊq*h@"ⰓQy#Qtȃ6sYkC9Z2yѵ9ͷpl.u9.MzhGTꆳ;0Ļ}:SOjkzhyZDno9(-Hh-P8|$I#Eu4kYF:ͼ=y<:S;a4Ao,& ]n:kAtm6=<9kri%ǒ[9Fx|XI|LBGB޿>V}kZ^$xq,^Bَ>Ci'GBޞ<_,FB8 x&d7sp~Dt'i!"iµwB<Z.{й45F%kZЗ=hRX^g! u -rh:#_n ;6Hkւ ^ F&\"ˏMy-Zx:)cpxٚ &ayh9^skq@ldD : dt) {CR(ZRyjO„;w+t00O}[.mXހ?KMuh? A,c稖@@pGXۢpӵp9i2ȼk#1p4)% ]3Zn ֎kx-l狉4#) W8K$Dֈ7Y_#tEDaI6Gԅs(!x8&Kxys12IA۹6&^JdGѲX!WF h c\+so;.q}5 / ( SA&#i:4`DVI!`)FC@aƤ0W s\*|ޞQҲtQ V?Z㯦GG!W,9kiJ(8U*zj:n8O|VE_."6GZ^.G1*GX#y| 렒BIh U1PӃ)anb G=MFEkxJT(%4>"!ƾU)_nBz tJN2d4ӃZ1!.&V0΁D<ƸxR4ydal#^ǚ}* ;PM|9Ot®u$r>XeWi>CH[GspVe{/%+!q\ kʁ[=͏쐶x+ ?h oZԑJ=Mx EqyU9/npN!)\h2B8Uc)V"[)d,1zCCeHV2!F[yeiU ?=ȂICB.*н1H$|,Yn't28@<sy\չ6dDuF|I >p@;u?{ bgW@pq.P!#-k,8F*8@ * (ӍjkTH>SD.|KVFּѭm G$驧nF |cc8F:H<#LTtվ`,q5u}G'A&!{a-/lAhh|6iӍ9zҾDžIh3e \<&G@ BC=2؋ceX/k\agI`ehG=9r+SiugKz s!k"Fc38p%TlG pq$SlsGhn*]%u)R?,dz'tIN97a$G*=Thi. ZIU-]2FC#c"q{P195&$d䰶64M-qf%䚨POxtTPqD`M  m’RѶ{?Msk O%-ub.pdn'x",O>_ \CZ|l7J$M{ iЖm1XZ5ts#5NK~ؙ+͜LĶ/7.Op< c5/s"sZTQJ#lsk*ZG<;'sX״!/A%Q%t~c-Du sQZ$-iskj hIMOW Ө/iugƦ!s.i'RI8.5.sM@{Ai#'TKDD"yҔĀx{*&0!%Q1}M's| cױR$B~EFGxP4T>}4<кԢP}4"#U 6oSjKK Ajy*JA;KcsCüև9 c:@!:7,R<4Ӭä$prړSSĂZ86P432?5&VNi/c%Ԣϕ[Zʑ (\Gp 0BQuF x5<8֞飨A|=*9.tPPVGuHatDAҬ]?-4e-%OWگ~%REV9פT_Aω5. Wp<}gK٭>G]Lc CL8RUÈm x.H9xJ*)UW4—VF潎%ɯOI!U8xiΣß 3,q6VTЏgǦ6 #,1ehqHG ҍ$az+k Z ibkZ8MyJݬcØ<69DR@%ڬdk&XGKKs0Z4 } v?ktti$8)^ ]He"i{oH<]q~ÿLSR߫ȟ wu_Gױ ӥS_:qCO=<Ҹ!}/#O 9'zT[sƄO|9")[$xI`ܵ+ϕtG 3\8h+;i+@]ŧ(aN&Fey$C\97y.w99ڻ&k\N;+cs[,+n`/G44:AN+wrb}>?-mo'qGjBlWG(e:Znc3>[2Vټ=[%^Ke,nm>W0L\<@ޘ⍍?}ΰ:2}Vvv?YM5dKcym`#+$ qv=b{zsZ[mcݾ9~܌weƻ%q6om6T.woqnhecYݽӎ7V^>8`v[ߡ/m&O,ӡUl|\[^~ m*\AJ7 {|-Ԯ&B .pTƒCkJЊ]w^k1w =\ۿH^;9R\2=gͼ<|b{KKV^[e,t6=VH;||nc[xsdX6=awɍ-dwVOei&깳:9[yuiP<}ڒxxT -CTj'Y`ڟH_`1[qVwpsiBiw+䍱Mc^YIsKȊlNO[4Va67Z'E$Eooh_[!kHՋdr{l]/s+69\-"yŻXyupp!1OG>\FRi[񛡩o#&KMc,'>/Em37>l63+<ˋ(eq&;# g&is'do`$ۻI[|q2O7qy-ܗW8PqN:8@1I4CSGQĎ5{Zkǁo.DՑ紖V\/d6m)v\ kq`ݽv` vgpGGkW/~yXU~ndsY+ZxOC=7|tZiFӿXc_.Wpb'Wiˍ͸ԎF4W [<}.YH$JXh49:DUqVX[a?Sb2c6oT\]ɨxX\ѴswD(H̰͎Hc.X~tCv˧mݯ-dE 񽎼DF:(gw%r̄g .:[g[A)/˘ |j5B* Xʭ-'L븙cwacLNϏ8<Ξƾ H.!N>81#mkZZD%Ƀ+m72o?bDo_s oH<zv/1qsa>d2X9$,D\CiylYwcy cz~fE#r.>r\1W#~QGcpr8mް-[dqײ4m/bH]%D1uA=[c3:j0[kR^?ָlp ̷;8V[7%$:_[c[g2KCSW=E{%.Xύ-~9km"Z5E{,l{#Ay+-u$p00$ȍڢH>N)-s+f- D]!Y[3l[Hz2b{rYAk#Kl~&sAu3 ־h.+%tu!gon"cC+W]n iw@q6t}6{ϕZbB/,l@ OXUDYlB;|GkVxحpic\ѸT1Ŗ^&yі bb~F6y@ 8ʹ5beǕ^1KC!v/fYk$Y@Z՟b_$u7I%I iuF!JV@?lo;=ǫ6 W|i ).m/ ?k+!(,{}PH48KYiS8-/D ͹.k빬}M(BFZjr6-佰F,yƮ*4XbguFK~>[a2siUDE>[+ƷVx>?60Eg-$L9]^iGK?OboX桲Zic}02ymɸ`mr"&msH@t];w[I{7/b0#M1ܗzG0(WdprozYCɖ.BL6O|غWjMЭZm1[\+|ubt%5wp>kJc0,xuN,u|l>BXI3|kk\SZX${ɛwwsw;mi3D wg:4X#pδ2i7޽7ט|F߫ːkT図fs69֏pd_\YIs X-|%ր+4i{+!4]ltڂ]8]Ay<,2ۙZHD! %81ںw[91HMME $s<68n-\\>Nb߅Ewϐ](X"e*I,ob-դvLYGn b-ҰGlqHuRnv[Zqxl^ӯLm0_g,JyAB渐湤U\:KC3H<׹ !\'y.nrzf6[\Í4.湷dPLrkQ@H S<}͌xŴSO7$[b$fF呗=ӂ༞[Hj<r!ou>-Oq^_`0X4c#; f209%||syjkq,mX|nKlXC<6>nCFM{3i\9qcibC7dX+yL|${Oo_ֻqbGX0N=7,JcN++Iu,$4hLvWnwtouL `ԗ & ; 17M+4 we]]AcqkKC-뉮8fB;!CkP'Wk^<+.Gנvηqu@i(\Y]>hX yR>4Sw3<}~_JZR<ӹk"w["K[{b:ce$i.pXtEdcMmoq+wKkO_iܨ(^_BKaCOnX~,/ydyZSq1ЗH^(PcǍ(n4{,}bm8wIt X`RB/Jgt)G5|>#:z>Zp\#iMca\\e0r _4e{}9WD\Qz2۹|k[7وWROO>ǑZL,읛dW [+Kh"-39f~-as]s$H]-8--Í |>7[Z6YrF^y.w5EIeJ,n\8Or$*Rק#5{HWܶG r G~##yݏ?.6J\[@(h* fun-omkdQYa#'0j͛l7HXZjy铯^<T ֫XXC>uHֶIcm$/C.x= < lyg&jؘݐ1_A i%q-F@iD\ql |yyc̮cֶYc hg厊^iыlLn,RZYoRX87,uČFȮ/ġ:9xmVf-ew-TpCr I ُ̆()k-?+d[lO1|q\? !c_q! C͖̈́X_D\dW0yQ FQjdcGs#gJ:g b)hOƤ pxPP5F >%`|rA3cs:/@kK^+ x$ž\2͉xAȄ4XK}QN+ G#Đ:쌼\yy6 o%j|@X'ܶ gʕd`,*ZNcoY-\ZXD-o!U܎ڇ<ƸIKIRp)Ƈ F<&>zБz UƼZ)N+u: u˝&Hi-iTk"B$fD^ssw.$9[Zp$ִ׮(b'b=1l8{kB#jXH5|17dnwHhh$II !9!M.{[3cnkI-PƧjh*8iOdG)b̌ mYI Xo# Vƀf6dDǂ99=J^\t'ޖԚ+K~cdl|`=WŃ5{xb"$]s:D*2ƹ>lp6Ff !:@4"F:! :A9+,lE6폸\1ih\"ua7#nX7p@$ɖ7?b kDVY$9Xt~Egs\`{Kq{N5Spj 4`i&0ZzZE9E۶{ulxo0Jg50!DוTc0G6 qp{aw (=ìblgi4<9>S#4<x.k@4G~d5w$t6Fcq'A<.3>/0}j/3IO*0 5j# j$xH*O|gkD1R zFhlj 'JHHk!kCq9]C@kO,Xl+⑖{:!ǖ=4k 4"ZM:@ ]yW̾FH-t8+h@ 8!z+0} ˒boYXǂAaE 4TʀS*z~R7\y@<X+^:VF ^RK8^q{]# EŎ//&#Ы!-n:eW|!Ű=khiNСp1Lb^_C{{K|¿k2AnaԽRG+C#,}b#}TO^-}`U%V\Ht0 t2cz`sO !ca2$x11P9C my|mĂ.-k="_ R*y+7IX$-dг4uS.j7ߦ_j%>8]8u hO"^I _ofY "H!x4.S Og{$ o0:\4>Y 6HfӘcpRE!͹oʫ).-c8$O++~]<95 J6d6| Ddz9 \iJRC hh\\hp骰mu: |?8}`K Khւd(Ԏ]]#@/V`%pOX4 r1akcoM(CBk 2.-h..N\>Tp}\OƮX0sfhZYQwP iGIZTUoDs8BGSEf}_EXhhiS9 Hu4Na+0?ȧ,Ø!#czjjh)Ezm-|M CYuo-Hs⑯%kXd]̸" b9Z5M?m{q sh!6{HxV6Xdtҷɧq!٘=< Ak7K$ ьmw[R*F$ P֬q}&(/+\1|lǴE _ZVh:uBd=v4M%H;8W}Ldsb9y ()Sԩpƒ[Jk_cy3dQJp:? \yޗ|UpUW&5j\ZΚƜTFId|%/9J@e:zCzm)Ok9%+,RDU Ը5W_Xy ldK)a { Ti0C7Qy%|z}Kj@ zE)9M9EZHSœ}̏F-s֓}JK=ۥ35. 8<%wud-sx78JV{N< WI%ԯפ~+8z(ކ k#hMx(ۇ6S41t\$ǃO&Wu1@"k'SRE8)BiPyrҢ+U*^ !189y'ΨQ?'t'{~.}^yu.s"]:c=KWȽ?y~_?|p: kz=^ }.uDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDQ ?m>tSҜ. ;%M^X._w+aHZ֑h{l[I1zbt,iEqy=C-8u(¼)qx*G+1 iV 9I{ 7qjS|,p2llru9tvN?SXëvKI,09k~`_kRZsWj[]eöcv?˶i+.;k˘dq[<9ǩEflOtNsZh%ŔiN.:hi7Vtޓ6sb\h mZ ӹ< 9lL$}iv*ǜfYE 7OZ(t6з!%-.k:\Bc~|a!+;fFKLɏFxϖKZ4!i T6U4I rzR׷IX/3Rc6>7È-CnG1,>ilcj||<[G2D{[sqNWt>1o``2Lůb.acr\9[gE`qg;/efy%XZ۝Uy6/c2Kp{wyʗ2ѶIŶB<{Y^lM:YI`mI శ}&d2z'3ګO>l;U: 94;%ecYgi;+>ёz^jM'>Qo x_iup6#"曇Y|Z;vF'

j i‹uyVwmY2>g-tfn66dؚ_ćq^f͗NPgm".}H-2$7s.'4EAZ,匙18I.#=he7GrE}Z؋O5yŠX]ߺ ._W&F\5.$4 pGDr]&ע {|ŴVBNtl5[Z8vc5s=>/eޡ.du֧ґ;e͍:o,:zU S+[m{3Y3Ը+iEFt4tHH]\ZEкu5n-/;luݥْ l,mZ0UsΛ_y%֦V[MjgEm1^m#.- !/};:F\ۛ~.Ŏ-\\gvsejC/+`t $';_nmg>Fq/'RJ2W2y-m`ʑu'ףVikŮcλEmlerWrsm:[-qFo.qwW l7g!ֶ};I68A8.+ U\ey2+{:&[fdw︲ևL-FA<͈uI. 7_Z{mbj`[\: ?_T]DqԿhqgRAFq1\-^\[^go!Xn8A vK5dۇZk&q}w dnXb\RHFtԮ(m:۫܆ԯL?!n>Q6_ۋhz:GDeg2a+kL+O]DwHF:[Q= %aq|V>vA.xL۰OϘi+c:6Im].dQ]\yVݷi LjwZq)en67]e_)ƾȥir]n\JCĶyX$e#Yn3HutvڇPK4W#wsm;ξO*P932GQwJ^qvmB+t`tpyIdh6^-5C'Khҽ˨ۏ^k ֔Xh|X=m4b댤813*ZAK\c̢ZBew)ulυnccwEY+izyu 9b-`. YV8pg)r_G><^ŹP[ʉM}eZ.`}z7IYnFpYO uDusz8Zx`|ujF-e<$qG$O ЀQrG^-6K@>q[6w>~i/\-Z6H# \ֶFiǪma Lt;I}5s$%m 'Xm7qDEK%1Q,9 \[u1ɧ?aP  J>qWb|fW--Kkl㑲tc#}O[H{Ri%?DӲ)Y,NdsOs>>͎Jc6X f)<T[y4!Ï"o|Ek!І{ ֒)Oj}Or(m3,-.sc{mÅٽ."^<(ŘL[^KlJdeMGO}+q| zLg8lv_S;\V{Fc&I/o%c`58бٻ8k4rƅ<<~:>8-{tpv q=YlC>3"il~sQ躣ҋXT:ɡ{noMA@JXhK;%LOkMv6VL:$iA#\%Ͻeh: |rp26 }t{z;e'ӷwWvQ?%b#}ZdNΦ9 p]=ZY+͛"isde,b%$)Yyhk%Ϝ1`hkxUEt j9CB+Ivgkbu lNA."GR'+u:#X٢яsn׿5=LΠ#Ejƴ0ԒA'L,u[và4sd6ŶDk:$ig۸.a}()Ăyhi7DzpqFyvdekhN EEnH|=N5%wOmӅVk!sZ*GCKu?"S;i [;ɭMr9&y'l=m|D_LZX)_Jn&Kc,,=daƍX.k-)UZ600䌗1<:'8qѠ zU/ ]]s}w Pu>k@g=wA4>4Zcqo3MDh<Z$jڭN2ky.m|-k#k^['KZ m}*4q=\]Z7hQֵfhH7T象4=Mh k $V(|:NH:n.xoK  aiFob2tt%y &5и T T֟D$Ѧ2Pgc=:4 }"E=eX}XLq2VF\9?yc= X9o2$pam@oHLPTpk Z i+$oh`idro0bz]!"5VLI =ܐ tO6"pE+Ͱ{$Yi=s,PlGiX?<jA4s#>+2%G$NC"W GSX$|m{Zpk\h hsu4ZBX|%]y!dNh.#ikY CڠmOPM(O9_! qIDC7HFI$mIV?*¶مdN/ x@$+ZZ{>. cb$@.M 5 phDqdqw-mllL>5yUC]hT͑N׆; x(쌱 ya ZIˇK s8S  ^.< \׀8|UG[yQX}b81lo{2 C $Xy.)(͐hKd+CSZ Xׁʲ;ΨeM<HVExx)isPMO@G­>غ^»ˌj%kËUUeK 2S,\2ܐZ~ ̎^(cX C"c^f7QP:Ҡ=5>+Ț)q`N2;4o#Z."xWc_{4N<#@#ҁZ; R<9XZ]XKd7! 5BMC8Xq<E,>C}""9f`ilrymƧ,dYZ+=OCW?8JUS8ľ(kYR\*滧V"U>jh@>jO%L2zN>M{}y+piiZ` #kGQsXH Aל('S[ 2;6Hx[:j*-&* >xZ7ท AG63p.kz[3Zhx]O#`:8agQQkWht(H:bcKiccE^OU2C!mF4siJմ$p'%qs!D`&ytP H\Ʋ7 *+ XAiRq41PMhyPTﵧ.*+Wn'՞T=o%is SC௝<`9g[>.{OAH*J`^O eX[CwHu|j9 oQ)= 2ˉY mϚ# F|&k6IsAlP>4AW-sEv`G< cs] Ck@ k[of֦ ] n}QD 2SG4X {v]Ȃ(/;kGYsMɤb|l.h{tb/. Pe8\،mo`lay@ =TǂvCq BDuY &H:di=\@WqYhaekgG&s$kU@up (-h"D׉Y ͽ6JH\[uxuru]nl-񇴴ApX *CZRb(dH䈑H\Z\ UHZ֐@< *~ %F28#C]'Ǻ18>lG$~*hbsᑦkC͑}@wa${\A$QIΨ_,au yk_$qq4 $kPO*ӫ^gVJzpqt[\׹  >'+J9Yѱ5=Ųt5yCSxTsV{F6FJc71H ZO* EH<>^.@xn& +Ce1PPnS,4Ԣ;c|SIsj<9 mB@UO4v2 WPkOS GӉRCO A'&zelR954wSKXZǚbi_kAccaaq/nZǞE)Of+ho@x]8_@[ƪi_ Ӆ@w)JWԨA{$>L&KOC%Jx"V;oD9Ӟ* xZIZ>[B#TIžY}*ETO!oyxxW2+c,yr;as exhMyV3GyFHm|tPϚ; Dt7'О1$9s̀O * :s#hcC##gQ{\\@q<66aq1<+C^>8 Jg19DPsB h5@Aޒx#$Q}X;̈$lqH<;乵8zY|s,3[#66*y؃s!75!y )ǐ-ƣ >q$w1/%kf{h+mn9nydo ˉdq/ 8EH1d1:ts$u!BI$, n%m#Ԁ< â{d,>'\A=\ZqĬC}<:7Wo@==GVB%Ns#kWK.M SBO%!cW 5ZZf's1N~cI6ӗ;[pzKYWQ^MW a^N8HֽǏUT&@ ^R8xR>Nu i CIZUm^4*#G p”$p@{qkK(L ͨ<]ϩ'(xz i :.%Җ4´XnS6::%.23KxRIȫ QT`Fb%hk}P>/I@AQ} MoK$kaY&sjޙq<Qs #Z-3hϳ*7kX8tB_#y2P_RkZI%܅(>Un \ /s_VGF:B^٤ <9V&ckR/.k_4?q.Jr~:.]xU Dy=GW} M_)?Jz O}53ã]y_HK}v 9Wƪ-SkʢZ8Wxxx%f-V cXiu5 euԐac\(Z?~]۫ri3\yVɊZXZt,ҙZjSU h׸ 6?nom2-`F3+ƻmM͵΋-k܎evFb;{1}guῬq]9"غyz]54\7Y+ .!Z=X|/3EG<+MQ2`J>[˜l+K[ɮo1eoyc1xk^9V1qwdt6S]m`dFY Ed+Q82xvlY7Y8v5s .wC畍sR eNY_ ob]}R5֒Z8\N8۫]M8}L6yl=&X\d{k1PGUR=gը'H\kwjpYKˌ7J 7xE쥰Z[4ɌZ¬`:Y65Y+RCVĀc]!s&5tYYC-$dp5qu,+29~AJqĸOdSC |hzS7n-kʖ#!mem 6l`b.!fjfRug8Ptc Xne]+f-˥wo@t<5p.h gKk Px~FBvjy`pyZjNIwk9qy{VUdplim so1p19 $kfݰ X\\ J7 qo q;g4+%u|q|A$RU;T(Po5‡}jJK7,bWiAdX#wbgQb_:I-淙0tld}4Va'ȲK7bs=.;s3&=&I ˙ƔX̬X7X}Euqd]vlo`esfd|BA$pS>ǥ=t=O7J89 q׈ZgL9M9wL<4b0lbtY__dnm9Iv6k1~0BX#e涘JQf{ 2'D R[龷^ZHQ0x M;kg,{Bk{5ۋIgyQHPp#L2:)71ŲC#_-cpsj#δ ݚ8mr),ftwwk$`+5j |6dټ{&d8۸'_gdaê1_jlYt/u'ֳzvOgnO)gq ņI[csОxKG-no-oS)st#lĐ8j~?[iCla]7әlՌw8HXH8-!tR?=텐H H<e>/1kiHv}n_\O{~O!l漗5iomWmڿ OX!7yXwe24ޢHu\}7Vv6Ouw) "Gq#:.T64sjZM|7s3Z162<KkI W-nm-!CisoWSEk,Wֱ\C 6^]Zea7Y@^κ8[d /qݱqi\.o.&yho\JVXdYѬKm/Gd5$-{TjV\g\LsDq^_;sN^Yo/0 ͘a6޾[c n<縕Wf9kREhci.ib+:̿a.p;90:y0< ..jke$y[d.d6"N1HZ5cl =o%I1JH߬ցy/;vofq*r7'l0ٟ5Y&ۆyk[+xɵ-u"mm310I7z)-sO. mgYSf Ygd 8Z/.EtMyU!̋82 FpͤWa-mQALA06iz HEK J{|kcu1n #knk"œV>VcrZ5m [lFѶr7Si8tV0*M}K J b(jh/WZ5E+bu^Lv.q7%j[\{Y,d=˒\Ѣ9]hbqm+Sm dǑV}uO] 11%ƅrDp$/ecp9MߏoreX˙G#Z8Ds7]AadlqnEt˒ =&>qƋctRױ7[^.n]3mWs%dldpi68ຉ\Va).H:.~@ w~r{ݝ6i,r6Qdo"۳[Mƾ2K8ej}Olnn]2_0nk}0WR֋'%u'Tg://zc; H\6WXSbgS ZjG5|O?Vyb1s[&Vo 46.1sYƝq7 CdSOaj/؋!k $Rʺu,d9ܿn2FFEi3/;ay \{%ٖL&.Pk;:_7Y.sGU+Ihy 1C]K1k~Vls`2w6)_W\]= x"ybsnwlD潍,so> >3^L5%X"HeKH_lc.( .cHs_h]}ϵ{ԑ}Y4(tC/Lmd234_JCA#t4_ZӗwlRVmneS;ias(ms!'Q< rXl{[aF:vHE$n~'h <j$k@2PAZTq]KG}s:{auGPu |iRHsGtLqK:uPXi'c涿yK #g&soU9E#Js#&# uWCF&2/,>;xD8Rx(_ǍϾ䧆;{kF-qVl$y~F ԿiT\c!?&`+drpO04>a.'hs9\~`5,{$~ -.y4{[krjQ3\1ĸ9:hE-lW$PMseNc8ZR781Fd@\C\H`|U 4\ZYkg{Y 2A wX1̆GK\HM8k9F' ׇ$־:NdqZQ+sPXC9|s +#zc&Z7Zm}Y+XD Ny'z<@׏"8Uky m@ Dާֵ܄ww=EcN:+ 18ĊB6[J9G%vĀ8!y^QϤ@5<0=UF*ڒh**l8d額W-c@. !Px RIpLi&kۊ͊@`x%߶;k3$ddnksLp$wC:œJAǤV;EAkb eҲO151{]Id c+Y"z2vgb!yFPG35'_Emn]o,M-\-u*.υMk zZ49qXCntwI,7q?mKo $US\eѹu#edrO[blq:)kNJS+g#g|LJ !`ZjZEZH.`jSC;9#fEV3 s KʆF˨o[8!\}Ydq.A3&C0 KEE|T4zkOrTr8pn泉DèPkUXc2ɡuE-c䶚At+j0B`sdJ{y+g)À$פ> $ -%ΑMx Qa\ט[_,퍭 T'xz J=TP(OXkG$mc1\8lUp*iE6Ob_Sk_xKKĭs&MH5E(9=lkKI ۜG=#^r<o/1ay\\ʐѭ44 ~c62X<؄OS^\wA%G30 U2OJꪳ=n!6-2@s"%70O4QY"Lm|,tsc }2sV9>bFLjgi<45Xko9uuϞKFU|Q8(H$9*]ǁzO^8J[:.Ȅ:ٗPm]Š +!osyWV840Z !ywA4H=wP#xtR4 [5q2Q3때Rl j/.`~O:K5a ,y@Il/4}PpX,+|$ѾGm:zb ж4.}JpwWCN>9[q9 kkBMUW?X{Ým,$HJqJ\8ǘ(*Y79۱#6PL:- PhH@**iǙXſ\ryo1 _U {o9|3s%^[Xg"U._d'|u4c7X1RdԉJs#(Ih%,&:# wGI5sy5ug6[7y:v89x,XxVªq'M Q]Mdnr݆9\ؘǖ `!]bwB:ʐ)^Jű!X%ktw'᥇_#D=Ŭ-$iJ䭣yKxOTe -tqtt= 6>5N{ 42R_Vu{OoH/kGP QZ Zr5T+X-{zs5xSNJ8tZ*H,kzO%ds[W}:kbsHX988IÏ*TUdfg=LlGD|^_"w+ek鉅p5k[C^ !* =d뉎x4`&FWe"R]t=ѽ +CV8C yk :.kX $TVuD-ϖ74H=NίQ4MG>`x^}"xUo@󳩰=ž[8Y0VjOYN!s@i#c~tk_H x9aW q y7N>}*gl6 a4TZ:hq+Igmroa͖Jw{DY(SЪyVHl4G3^N?%U0g"+ L`eđC^cMj`$~s|Hfp斸|*Vor+~qIR< }Kkdfh$cl-s@ZfBTx*- e^z465CĶX%t@"X SZ¼ xdb36h=@] ^0 n|s277>G[ .1R8 pV& EGK%>ƒFk\ן5$+]K|ˠs[NX*5$c땯kZ{5kCaqs{:hJp_9^!sdNq]{~Wޯ9xÇ1E2=GtƇ4C^bal#8ȱoD9HWsZ \hA6#E8q5J# 1:ZI 3ͨKMMkBuz[Tei]=_KWs?_)1˥tSR^T]nn~_+,z?Wq֟*p*<_C˟顢 1NG.jY+=,5dW2[[}%&_6S5YYլCW!,O"h׿k7{ySkldg9oVpw߮;Nˉqw{1ćj߽>=Z c0N{<>Wo6 ]eӿm82)|-zrE;<\W+EnBolY qew-cw%w儲vO*K}@c.In9Wۻ{kP^@L^'U x y`sf"q9;?r!sX.Y\DLn .|]<#oN^\Y`r,=2cn1rYK>:̍RZ9j9 #7e32hn%y46['ˇ2<v7lwDBY-C2:~X#eM)fnu 6[jL{:oi%dYRTiY+/`28='V6wj *V2[2XlfF&1cCnZ t=A̵ gF!qIҷ֙KZ{dm5'eKi&ٺn.Mw 4ݣLu%HsH<4\>[p0,Iyaqn R=de쑐6[Yy=!kZ]kl>Vsnp_q~ocP͎s$Y̌sbܣK_d1?, [K3R6Vj' sXHmӟqegzޗ hpY㕹t6\r 3I 1n/wWOP".J&\35֣M`1֙ 31efoF{^Ŵ4%Yٵ^ k)n(sob{˘]%(i@;#6b%gU#4^N'=,1K;ɌuI"):cL!rl68&&czLj@{A*;:j|n׷=Gy7W5g!{`p}\̓q}?ytκ[APnmZZbeu-kꆮ^ڭKs^{\NVl~ͶcBSo$ѼBֹs,:_%wԖf]ez;lWR vb0˒%TVCw#poQS43+[;Wj ܼv}'=QY+ct-izC>1\lvN\ﻒ߮cnW2 Yy7@ϘJ3n<گ/|re1XYs\o,쾸Dbhӿ|w8;gie|z5q\cX s-b {&kDMc&ֆgm_Y˜|PA-LgcI+Z+9lc /ac/̋$XŎ95)̹{)#E$o28: ǘk:n&+x ̾3 &,s( cba{1ۜHR}D ~X}7(0³ RZˌs1Ͷ " [2kdry89{ 67Zv2\4]5FE}mo[LMk\Ǹ%.$I'&,k(z1ymݞQ̛1Ȍ5pPZ\ώlđbplb1;IA=99"[le1u$X⁌;L~4>A>_9LX+[cflWbikm sV.Eٮ ^6VL^Gư6Eoi:PN=>U/ ̓>0\ kd(K@VmY@%"KY?f׶\s'[x-uku6quG]am0ڇ1Y,_oz.^(G\#p8M?}Č]apz{K?G#{{iݖxmZ\gV Ǐ\]n1 \o6H寭36VV׳}k9whٱ^UOs,iuAcaVq-ւW\Ycuf [k٭ˬscc̵atǩdL'n 1u%'،en1wseu.Z୬]hP}$[=eߐ k4"i{OP\9mnYg//b1賱AKKqQltUf9mݒ(c^P6F2+y%̰x2dY{2 !XHcXcu +߅Z>'[:%{tQOw1ַ36k+6Ar<&3:/m'1c0zEj~/?p4c9myy{iklCIa7nˍ-g]uZ'yd{ڵ͆AW;w}")Oh^^ƀ^3?ӑk3oߊوN>x'9J֙o29KBy\6Y".p9 k$77iÍOJF=ui^O %<:U}EƲ;X+m tL9s̀Qq-|}ucXd6  ]9桃m@ ZCh$G6!? tq s帍hC(E8ӲPpE<#čثXf6YS\ 2f K#,s}C+=Z0uTX|1Ku\]H&yszin_GsQs{1O+s7ա[j$g[+@^8 9F>f}a683[WA<8jᒶ`Kcc2fg#kNNHiÌww:gUX&Cs$/+\DA oOQ|l.`T+Ms潷+#w(mݡWKѬKKu{h5!ϩ3W19!iVkf&  u 4SjxlvkkXlD4cKv$k#HUGhC{a;M˥YQ7M܂1= c1:h-3s\iqK=6|qB$'kLc[+h mM-ܭ.|N }8x.66(֍w =Ib);xi- x丛ɼ2y2#dΞ9:^(@-GQ)XL֬b~9љht8dw[  H63ڿXCmibdyت$uM)`ɱWyv6sm麀_ = 8_YMܲ3D>6&wᣁ!OJ3/%|Һ9i,r1P$qU8<"9Aw6@R ~.+#{$,L^n{ c2|U]Ou{q,iW:@e%[l~  4CN.7X駭-|{h=4WH@OI4 GW\hq-ylR5 |iUܘk/I#1Mns\I}>==Ey-G!Hkok4Ic R8QC9uPT- 5y[$b>I-%\ׇA?iÊײFz0FKe-{p6gtqO.:w[%Lq׶F>02xJ$ npէDZuWI+btRUC6Hit :ԅys85swT-!%\4(}uVv6р>G6Vt p£E)Gu:U=QJp +KX'Co$hdG/9dE|UdY5:9d cl{dPCIEczdm<؇{.$Gf{ Ai=Nq4AVh|UEnn1,lM1Md.e%ۉ9`1TzˉGcnWY bo$>H[X!1Zxkqf,Uk:VsTyƵ5% +NccF}bYdk֘z|XZ5<* Cl0dl^6Fڹ4d`k公:fw%hK@%ΡSq4 *;#y<) Dbhtqn"9sosϯJljZ#.w:h8$ilk{oG=&kw ̞Vo==S %SZ| Z*j8HyOVsFw\On>IY]iWh1Zy7hݑ8؈- wV2ؚ<{Up%ԠE1Bo$͊ge[9ZGMjkEen~BFl-wH@['[qiC§ P?qY[m-x!:G;06BgdoP+Ȭ:̶Oc22Y!s-qR y-lm%V[I1kMG$dqH@^j[@J{,m9|m|Mǚz$9ꡯ Ŗǝ]FY#D̙!8u9گQY޽x dgFǶBIaĆFqo 4xpU',2I8 =Ce K8̸͌0ڴT9m@s|Ù)A׺+L[ͷajx(-\ 'y%Hַc!cjִUuv♒:X.!0#x#aP9101%h-U$IqtkZ\AsbccaxTCf/NAgMiylc{"B2 qcZhւӉVu0P>֎/y= {#c:P=RtҠP{NgBjk^ӐN4>SDhl:Z^ D^4{&G TpK>!ԡD۹=cˈlI (AQk5-OP]^CSC#XX\%\z̯>[ǤZ>I_Wy8]1H Nk䝮ps\@cGI$ C<((!\9{ Qe8T8Ym ӸoyJ' 8pUl  tty0:q/^Tt9ܩÚ fw=8\VX4PME8+#%.H8ؒ ln驡Bx`<$Uff p2VDbC 4҇_Z*8WmER\j}8hnckaOd,# Bh0*EGHi\=HBRO"PHi -<880VP&'>6004ZzOKiV|J -1֙xS4G$iZKf!-T̚C̆Ѥ[*iGOJk1gx o_u7®w!UYE_q8׮:񌺠ʼj@H[]|*e&aDJI- hpN,z4cr8ti}(-$dn,>NJH60^ޢXLfWt1 7W~$rFq{_̍Ky!JjZ9.pauOU;o3EG{]EtNy.qoWKdQI FNSX$-`V8ӚF$sd% cH8W  euhɏnV5>6]IvqX/K18|)5t/ڵӍRc,WQG~C[b#ds<։Z|￴ U`7 m[]9q2rWT9;. ]q/C[tcmd~xtDgu3jscg%̕Ż v_[rcKi噯&):+^"[quҗvkwI m4GuGsAuik~9+WH=&%263=54*X$iRB~L y>>ѷ^]Gc,Η 3ia}zu*(鸱v:S/nXfa'mmw`dκ]=Eѣ+o/&;#69Iߕ/" 7 SxIhR8UkqKOƁqp{_GrpY6C%&/Uqj\~[gߎ-;=PzC_nKM^mu}bN!:llӽ20s7i5uɅNe+0K3. 8EVT?/ RNcs ЂCyNש{DWY5g6>+yFX{eC40,mmdi uV5u!uJBe2/dYgl5u C<8,\^};#i}c>(I!}]~i68@p@pqKsїG6cWj'# {Y0ّ,6X>K!V.OEN/Nev6-n!teVPvK|n$m/ɕ̬+|n&Q]YR]}r:"I,vџKHX峭>gD7RE$ǞK< 7"2P 8_>&H }i=.6Ѻv+{3~ y[5aSgUNJy >6kvH02> .}%0^+]?C68k}<\'{uĝGkXK,bGgҶ8"8^7++Z},Ϗn6rFR{*w RK뮒Dp/Z pp#tFM5c)-l#-\A<^^k7b!.DHX zF20 {X'q1incZ @I霥ƲpG3m1{8l{eVS> \Mi{yk`/.BZ]`%Sg.cpf:,N.w۲F>g q=UƷG]A&nOy3#k4ݳ͕lWOD0\ c8y$Vn.1曛lEXm"!e{-J]ye{HlF I|]!k֑mo:ŭwֶgtv|v6v`-mlEjJZ۬0xs6XX_4`X|n)aċpOsHfYhwwd쭥fe/ƳʷePT:FrI`9N`/.,jlUeퟎC4&\_t$|#GJ]c䵧 )[l2np{IX{4#;yܾ>lU[&k7 uq~fuLtfiܼ5 em>B T,벆hq5UctҐk)@ ;ΡԚj ܌NZd0; a <oC4+i<m̐⭼da`F4cIY&IgXXL[Ag1u 2Xmm+|2>R<+"9ֿ!-$c=_Y@ H29@ gƕ!.2y̆;#Է6b؝@Yk Lf9ttC}Jl&Ye_3xmo-o xCel:w׹ځfdgt+kkg-Vc"v-#;fJ(uDPUe^b[,W[ElldBBokx0iZ)6Zc+c1ϰ4GsYVq0&(Xyṻ>ܺ mM-1ڶp5^dkX4 ]L7kM[!~Csh,&dadL)bpOtqv7#zvqebgv9vw^淫q;>GP1zN}K,' :~]?eM\,%IO/TVH.o.-'uM<2(h`5s:9/-qj:c=t} J:\Iu)£&H8m,s]Z;?c]"-dYB{|FL;wnb6|#*} 6=+?|dC%ĂP0:R73^6Y[R8ck>6HOQh"Ty>kE.j%*]+<~6[6LGاE~sawĸW?tT,lr4d2Z=]ox2^'|58Wѧ_䵴p6rJ;'8CMsδh .$Ekfb}hC׵\Ix¼8.,dMesk{etOh-k$Fx\SB# ,dS;8Ů8 gT9.*Z.Jl"۩ZT5dOukn][3 ɥA}ubk%s\E9!Z&0YϦVup+ l:[JG5Ck_yO`mk4p!o[ꎪ1XYK/qʊ2M8e=ak'tŭdqhOZ1$LrH$| H">C-c<:-1E x`h dykYkkq ãlEu_[GFasBxQdwV u4\i;yq3.bSĘrڽ2G!v.ql^fN8fm̱yr!>KQ=4ϡiͽ#aICo{c:\,G+Vo uu2wA>/5eߓj9 Ђ MeÞd^ܒ2Yu kWQU-$uعd/݌w\Kpǖ\]0>ԄѽN*X̗wW.ǶIJ:F61(jf6K5sikxc@.]05p$ 7J:aίHpZ@ͣ&2Ec|BX87AZ^|c7mklKPǨtQCʪ)Ri5 ppi#lu=:,5sH+^։`%M>^j@|V~ׇ2qky#s#V"<$=@=>@5 VM*} ֱQ( 8\CiH&+s >\n/n$k;!hkZqIlEm̑.a k58OdҠz:y8|` pE#+l,h=1⵩|yWn%slR)%kC4Mk>gg#q3˶pqi5M E8rp$p%띐Z3؋so1^V̕q_Ci$-̠.hcD8mB\d3ltuCN H5G< x|?zAdӾa{:$R,eݡt^ K!˚5 k/m<%*n!l^a`d5(s#kPA>󯇏%g=l]2vd-j׈k hsy}t57`{m]Is_ZB4JX֘C7/ߕǐ] #XY##kKx>M+4Q54&w  sXK`J$+rdki%qas\ZTpODzwSE @ SU1AKC#5eXKY:TP9)ZΕE$Eh+6ok2\1GG#oP'ǒ9Ζ'/[1 I y,t1`*SÇYt+fnD15)_,{od.װmEi4m 4O#Gu#/z)X5_K43=yy-o[5-ƨAĵ *+YLY 1G$WDd| ]%%qcm 4)ĕ`d|Zas=">5:A2u:G2GJG<0ƲHb -t|n0Px( RLJ."Hr,<7Lo >+rdni4q#ÊJF>Fla--@poRӚ,cguRG=ya֏k>:=P<@{ vpu'#{X<4_cWQb$[r=gވ&0\6!ǕB,hdt_XdQ9*=yE? EgVh|v]ub؃SZ }Y&@@ŻA,ylOl#]4R3ib],i,9ő -8 H"Ў*^8u&"_%XKg,R̆Hw8y%pwSE.2'4وrc 8Td{X˛toXz8h}ҀפTp'U~+%&2lwLN>I6墎q ꠪9s$Ѿ9Zv$yoDsz? s@ܵB|[z E8SxY8[\إ)SpQ!=)N"`k\HŻĆse&\9pk Z Z g{Xsަ H#5\xJ4>$Ҝ*Xh@p6:mZ=,POfG~uKw|s'؊ZqXe!sˣH+̖(OZܹ94.'q%^ sg褆p׹^$uc.sgeI$ \Gl~D7A?T76td{ʵSZKzQAU#3r^,>jmxe/mmC8S@ TG*Uڥ+RO8||X^Zb2$l{KӈJgۙ!kom$ >fXǑ$oKϤH *fGZa)%X#Km$ϟWxA8':p@(h(x#5IEΊ6>[3knK|~]A2048 GlZ#gM<ZL}w09*l[pæ>8t+ޖ9@ U@ pyqQBp\rs]%sb<ä E)[E̦I %{:5kc@\ۓ+\NF_ `k*CVW֧ꩩ$hitאOU78$앱\!8AFd- A™HʆWD"8,GLxJ kC^6LN#tR6BjM)<)J O* 7hȄ0;tqۺF9ӹ13 zO]C]Q3]PT1+w 2 y!q)XLm`CD 8rV0A,D'm3 NyGG %X&s;CK䫍+X{&V} HK8 UQ^*݌Ϲfۆ#K:p{&4SE<sz#C姖x5h%098J^kx']iäVפѕ=aVm q>9ΫI'o򸹲ӪV! E[E)UNi_yO-yN\(RqJQq.$TG#?Hk!sY C+KK\*TTi_N֎췟BY 1Ccuzm{AusY|79 t WWvu5h0b2 {*kϝQ~:Hu5G27 \Cc}ĭ.qZ2\ [hfk&hm@apk[>TU:J89Ǩ68 @G0xS$Z=g2~ s Ι(:ȧH'8uk&̑Ѽqi 'A#l 8KlGABO[4vը\% _0mk-D|ns8AEƙv#|gge0Hmt\igTn9`wЈxz?}q[N=k3 fxn'I,x6#p>K:< 5gk&u۾h[~MTQ9ٍ?f#㪞ˁBuTcG=.>k}k[07Jy߮Nds]oi#Ri-4,nj|f,mn0\\8*2pSs!p~/Xh=V;=')빲LM`\֌}v.?YgQkmzN~1ihj ;4yܷS+8noq|x(_>6lݕByY=6#_3{cBK+L{k${-繷k:j7Aa$Rjxy6)mMMdPe1Gc$mwtw>1pSanae1)K8bwJd()h|J&[ b(iFۉs%nJ7#GgCbyarɩU C;ܝJ<* _>hd8{{<Qw@7ּyf1>d>$8M&[= t[?,V6XVV777#tLpCzk+[hmaXlK\1|nsâd^F <4+൸p5s}$nH}#C[yZoFr\\A{Fu[\·1`e d6^/ ՝ 6l̾P<]{0z0FI#Yf ݵ/֭kF_^>~F&.tM&5ǂ nsZGM:OKC^װ]"čEj/:hѨ2؜ZaŶuS0Qۋm\IsnrR;.#o"`c`'1C@8d-s̭_M$fr[?Q|N~X(tBsNqsy/?GԘ=OXٖX)f12䙑É6&LO,wM8X׷6rqX}Ђ,,ֶV,1<k ɢz]|jv>3n\Pei;M!35e5[,UǞ`tP4B b:&0=Gg{| .E+әk ),vud o 홈!̸h卮oCX_3!-w,b?+,e H9\-yfa-ows&)!_S'l28Y)Y{XH.oQk9zyNc1&t8[p#Z9i;Hi&ty;(4G׮?%s;+-6Ym 9%sKz8 lbmq9 w1Z]?Vء#4:+}o.巒:L|͕t^H~Fm][B =rًromcooyWdkhZF}7|Uq8jkb玥 =(.orKLie$f?#ɒ wO$͚8,]ɒ}}Ep{&>;7u<>^O 39kZZeA~n1͵ךBłk6[ݝ3!k(%}|F0[}BV3QiymeAȵ;"[mg:J}t vd& d!mcm5m2zW Lt5f74"w O5Qό ^sUq69Yl~Lq Fgssj襸?ϐzz@Ș$q2c2\MLUPZ13AyKDe&Z[ b5[4+WIu-#eiۏ[? \zTC6K',6x(g47ApasA}e6Y7H-q8[Tbtm>cam:8_ecO2۹\][ VV]Mqum,y S#l ㋿,.r1YmqA,Y턗BrFRDHau4 )r8evW͹9|E̷qھ)5WS=Y:O2Bj;8e->:w]^W0j$:z@/;c-Z^YEqx;v2GuyB+8.2<8) .iҺ'omf"qU۲Ep ĀC=4q൜~: L r73bq mLg28/c]#F PV;u0 yl,ǎky{jI#qrú\`T-aE,\bYj}b_mM+btx,{'8 ͂' SAsrx贆֮a,:|@Vv(b9]{&<Odh> mqjmuۯSXy=c$s#C[~iH6OE:_ tpMגA%nfxe՟#e=,r~-ou&[sqIWmL]=J)wOK^wٹN|xg.3!{xE`,g{ȥ`A|r]icv[F<G&*9,ڏ'icZƎ:BʆOb7gumLϭL.'K3HX=wO[usnap =WY[X6361E#EVx7L}Sɾ#m2 ?-cjElK"7;c\۫hw/[s/^Ji|rLC=XC,Yƽh 68ūhl7ҽ/n{]u,[GPXkAeO2a33)+OKK0Ok6BVKAwxfuE hN|e770d#aX}c,70w7&i!!͐iE?waq:? vS֘M)ns}2 c4Nu7_> <:׶V{װb0X`ݮcMlA}p=^mbn$:3:mc.-Mi|r9m|9}m)Vt LWvpZ!h&n'kKiS[fZOnOԚMdv;,ſYwb:6..0CylacޗʻJUvB[[L=),бE#z\A.N 8Qj9r<|bwJe170c#{9`#[k$wu4&Uֱ&3E- L7Ψu-&!iP.wK}(I`R[ӷRXEo-3158].h|jOU1cm?(<--"q)_Q?."ӹ B2i^F͍76([$V3W.fd{gc8#sHޗ :XJ'|a4 {96V[Lț%a`KA.Y|Mv9} )W ZZG$| 7]Rˉ~ 7L&e\ZCsd=M9":>3e~Fy'=}<|/tAu=䗬{,}8~3Czj孁dސ紑,f_ r=kۧuwQg N>8l.D]{rc b=n$'5p 4OY?qCƔ SecDQÅX̞VyFE׌s,m%=#DPCug Cf{Hz-D]NEPx~ל;=|TN9%O4][I$?8dt61\ Eڐ28 >W[%%:wBX\AMkot[ZZ}1dgmNŌ{m̆gGuo$d 9\MvPI$9G(|8:FH\k97XW;> .-N *K/s~<=\[w9eq- oHEd|rEo|"]\ Ep֯$,iallJRHz\ZpԲ1㭭$0䤎7pik ƾ͡ao1H޲K"swKF+DБTX̕Yl C wLӿs<$ }lR[i|zHӽs_tǥI]v6' \C5l}q >xZΗ i1.R+̴A=c5۫,23W1tyֵqmq{-10-,/6IXށu#ý54E]mwt]d.l`q{|#tq`N>Rc1]Kyӟ rh$/kOA/pip4Uxht>Ⱦ{ۘ60FCXCXc-qa&YM%6Ԛ~]FɯtYk-\M ,q n7yCj Zm6b9toԬ|odƜY陶>R VW"q-{R~ݲ0e 1"c{5>.gN:-{ :|irOl2[*ݡr!c\jG-wMCzW_V;$`k -gPlmk*g)ʜ%ԗmIħs.1z,cE*xpQiBE*CH"hfqX p5ZcDCd9"R%ll4oi5,%̐4IQC/_]K㫜PG@#RM=dz%̐/.k6޳҄s[G9t[⠈+|=EE8|`{T-q5𪰎F-De# do,6FB8u8י$^@'+Jא񢴎FeckZ;ُ$ce89pZu/kms9Y,q9|è. m{tA.M/;^Χքq+ |!񩯩kwB msOG*|eA\> DaNkE(=Qzؼd[Hn %tb^򩠨4kjiPG9*=F"_pmes_A25tz}ǻ(Mk|<O`*7tHC\t^ؘ88ПH ^]AJ *C n"-hVF9\փJЎRl|psdԗ:H|Ⱂ6(,Ny{|9D]$AOO5xIj}G8Sœ[r\$-";w{. O tq{o JIi+B:H& N*<(m( J<˅a,7 yKcO%}W~PΖ$ަ4Ї9]B ak9Kp}V'y}oYxo{etQ=Ltux)xR< AJ}r\I+%鎑_es^vKhմqTlUyi:PA$tP5F3#8=iq"q&Xs sİ>C=ˍO:ҤU)•.=\ S^ʚ9^$2yRD xIR)SW)"l>Y_$t{oppi&|1_F0@@sԎsJ|zx֢LjUzCs6>Y-o\6[9-J*CGrW.d:9.7eZ网OS8\Z'K#k6H^T$~RO,r+"7u>9$d1Hht:OW0|C#<oK_a-,`p1-gI 128zYQ18M'EK$@姀o)˕HNJ?8 )7t kIw̹qEA#Ujܹd](iIkm}-ysV۾6_FטCa4T8?ӚYalom$ϱ^Ah%Ѿ>T#A^=#^JcLREqY9]`,gЛu]BGf[n6xq[~+tJ.~\& {)}&C^sYWX\J6CmX>MĽѼ5q0$yB8$D٘{ZjY-6 x_4N Lo2 Vs@3Ep'tp6HX@am*xlr27W}] 0F(,'#E@r<PxhA@K$q/02`$ҳGAQ "M8K]jE~O0U]C_'Qs]cX\#G8״@^4X63apchVu(c:%% ȉ;t[ˠ|qX4xz2٦pc$BAs[ c*'po;@&*_s!:X[#5`pm }J TӤ;|k@ZOU1==n#?l,e +-丵k1Gǩi%si:79ٌI Dr4UY'`H^:1Ѵ8U\ꡩX\tD{VGԵk΋;][JpoHB\Ac\ִUZܴm|A͈$P<ס%= |ٙ b1:d=-x$LjXG\WPh2Pi5KO*!qI:j ,e鑱@0.ieZPpRglIwtKDdclts}B>;"sco+|jF\+Ky 'xp#E3 ,ưI fJ: kB yPq[ZIm>*0QōoƆ:Yk×c&i0Hs/S*@%ŴOZLt\@hp ^4UZ@3q uUɡyqCh< l<솎[ p#YnWLZ@sZ8l@Ѐx8pYv4py# [ANQҧ|N4t-{eı5Lm#CZPH6XDi^}c%YOM,e i׭ili}*H{{xf#piSZA-Z Z)$ҎiUhwI!CH6'=6Ҥ@Q wSM*_7Fk$.105=!Fgtqm =Lj4>qO[Bfmoo6;N_wi:O3Ii!>2CKͣƒ{3{Fc4طpueeWz{x5Ax-v!C{-K)~׋K-TFn{]|@mU.u/vĵܑw/ri/mkڱ\onBR9 [uFӹ)eq?4kW{Ibݛn{&Hq?}9^]3lM}qHj<!,hA*cMG ]hXmGnus~Sh<Ie9)%xsK9v,cH=~!d#=Q\Hxx\=l8rH8ae.ұ-n3VH껩IPm(dĒ @Ywڈl不RY >%ƚ}c$Z?hwS:ϗZgUNjEyt҆KxI .j;?i^eb=Yv/J@cHmM'Iy-ֺ[5іg7gAv6lZ#pŵ< eiE~ٶ|rzX公fBammF>8`qV+^uC,@d?l9=m} jmW/&&ݶٸzGņqEgNO ꃒAXGֿcؿ8c?lTQH3=lJ&33q12.!f$u=BF :xT¿밴q|As oQ]ISBO u %Խr 1dPZ.nDT#Kx!;мs>G[>l7튳 C~"8[$mĖ Ems!T"4]_awۆ>ksCWu39 As(EHF-°?.Oo7@Kgb.6v $ BcshI.z{+ⵎŷ"gݾI-.&m[:$-%5ŷVi{6tւ>h„ -5f\o"khr"ZoFɪ[a\'pqFz$ P8kWc6-!l$e,Y ,2[h<3 |LP޷qkm~(>Y$F hk߹K-+dd{lq۵:)XdX]E1OLs$C*Zܵ#g]MXl/NnҢ+8[ȭhtoku\(euT^ۓ [[g=^mK `7# DVٷCfc{I. ʍO};qݶm7 $IjAQqk`1m,oSb^Euu IKO['m}Ayt֯6MެT-|Ǧ5$zcR[l %vm]F w;~-7 [G]GGiY=o-8-$Ik,ѐ Zv8|a߼5%ya;%n#wv^m:;fk1A~Z wֱXai"Ki%a(Z+DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDq#(H^ WSȈ ;o1s\ZىۨKo2Os?[OPѽW5 rL.+v6X + 7'F,!n]v&c|>[p"vm[\[.IFGNlL$o07uw+;vEqI2ZjkvH捺{{}8۵Ú5KL͊՘Aۮ"ԮO4 G7} myo<c˙8ۺ;wGo{ߧ6#tZv-GnYKݽ"l 4<8/0jxY} Y0{%mˌ5{0k긽WY-ۊE %ƪqB hX//2e.Iiph,蒭]cD͡t :|ά ז--4C20cto֮9Ůp.8+w\Km-6vp.lUXި\QUGA>3oiyqm4 l6g-$ޛ9[HX+A-U%yGM: >qX8lN+yo<6bq:*%'is\sJP3*=@m-/Cj)&k$љmM=6M!fln$,]ݿԲigKR\8_q:k}14֑̗c;[#Ü<9{\@[--05o. $#u霹{d/ZX_..^Ť3Hde|.[qW0Oe{|4"|mgk:غʐ49a$[ 8Gp $ZƜyqVZlNbtu#!̷vNHi9k+mcdr=k.{[7ZC fc05\: ,1:W)diE*VL-eXÑƈ;n_WS[̮>> Rv7sD㵞HcX{*水0<q ǓAjCi}{s49+\Ů + r  'myn1p{q}pvs.,{NMC)},2UWsL]> YL ɦ-[W0K-uK]#>hVr-)xGcgė\] 7A]@!Zp<٘ hlG&ct[KKZ3VHΕ٭6mIW:9Ȱ֗Zgi%._ dV[^8{1Gx\~_Z1)`[?R!aK c;?r\VZkMEk K+i#2>:GKOPӧ-k9l%ŏeeљIKo ysoOw&7y70Mkq\ ͎Vp=<qX ˽G^Nzn[+y,1JkcX1\IeO#HֲY o/牢+l 'Xiń_7<5Nu/ dPYn$}մf2丱}6JI5҇$Ӎ ä$d[U4K >Jn[+L3)5%#FOl?Z(]u).'aZ7%>6Z/B\~mB<6Y !X>)1N^]ok6o[\!LΨ a5<1Yy[D"G>m`ƶ0]+ƽ]4NӸi˽W-1xk{eqfc c{i;)%]J+zGMYfeŘm~J5kNRnez8Pyqְlplw9xb᭨3blt:^Ui4NjOmtd#7\_&%+ ,ayFwY k\Αvo2Frf c3Β]8<ƺt( .*TY9nH:%Xt}1OHlR=Cv,qmG&荴}VmwR9oKxA}!Bռ͵z˩M{n eM8u6REmSee'hmY 6K᧶$6%2V[z~'+X4RFOz]Ec%Ek&J耖Nճ5! {Ͷ.'rX9!nm2l͓J\/./|2zm6qRh잫p65ݹ@fQ"Hރ $ˊ۽K:39zJё,t&H.=R1CZXۍ $mU[=Ue;%gdfOHG<`' }p58G%WBrPyG%VB=kn#pn~˛kr3-˗cmy pq嵠u.iEwk-5cոcp>lnR>k,+ܾ8am }18˹d`a_Fe5͉G%w7e5f: a>kH]|Hy^k5zJ:V۬ECPd]w{cwM'HZN8\]5&Nmc6ےmw^4Acä.{`{}5'#{ca œosuk-ˮ&g8͉oMVq36bnPAa>{;6ˊo9leYia]caɋ>(ac#$vҗsn]㬲l6W u}gqa_S%m,ma2W!M{>K mgwv\qkei]G/UsKKe4dY Mx{l+䟍V sB+*O+gyigyvW溷o\ef6Lv1?gK0#XAʲ+,Ϋc6f=cۦ}Ŷ6(0;NicLc-g#tuюbk81jxlsӌ>d!j65mcq7lNc^e$1}S 9?N<3a#ƲZM9,{N2gݪr69ClVwv9;\vԱtaɉdˉ/C]l]؈nadm)&aV{$j[̩U3̭O#ovyDv[ FTlQxL9}K1vm#m7,dh.wkL^X^]E."n {S0xK٭c.ȳ ı#d=`TUm==2$W76+r7F>Kf[,!5|1|}6s #Jgmu3,ๆ{kgJL0+TPڡRXZ&ʹ2dV xz!֌c0aTX[cCwqwE*>OU\qSC>QE 7%/Ka.g.eu,ƫhu^YAfqx2WF~)1 d,i?$!fmEnGna'-ݔ qN6F>l&AI]E;g~ܖ7R_`]&KJ&hB tzo=h/%\/LA cmmaV$z}՚xww^.׻;sZ]+IŹ{R[똮qYwO <]jZTXjqi ~k2fl~~-Dwk$ɖG3# kWRw'r_-)c];A+X:\..q WZa6yj)#pK]2\5AXlLj[,pq?Nf/\\cAQ7|N7P kѼV^H'Qdg4֑yOZsAUF ]Y{sp2]a20J-X.deU^ -g,O#w52wtck#:JxZH{iNhp#ҹ:o09<~Vv5(s-3$kg/ hJR1J"|@_Z˫vTVN!Qhk`tֻ>4&TwGox)cclVFٵxG- !sM7YDl4PבEuSꯏ8-D_ tM])5oyN=-u,kDvshytE I%.ٌk >Wc^9m*?ß3|:i.u-!}MâGn9ex:X?J!Z#w%&+e=qzi ԣN~9sY~2\ חZ#xɤo[\?yNa- EslO[ -ut0kˌms&qxP8`%%9[ϥ+ O]'ĮJvcf ԡ^}@ y#sG#oEĤu*^6Ŗ&6V]ܺGţJ:x,]՛>k[IN,p( EVk.[ɶyK~.M~5g %l溎[#mhcY \}]ٛu,qf4<.cllh<'`Ij|~S+^ NX+~4Ä6VR{Z.CSdGC%vLpK3|AhL|bR:yzhIc-laՐZֽ=[G Z*<Ư9 O׈K8nks=d[G)-L֊ -5,+iCbCKʴX͵l͈; pV|mkjGh%77X$Lyvs;n>_fkcR֊h뛷L݃yW0g{ǘZk{x p\C{hSW91O40>.րSΫ#{y\>]ٮt-&c 't87.;m&GH\ak{#IHOBmv.$`oz:JӭƎy8TvtaeZ@cq&2&$D2GU=@q.ֲ NaLWQ{:jTOu;I%# PÁ)Jbl "H`t"$OcIyH洶$)67Ld@s'$p乧Ήkhx'H䎮d4=TsOS\=#\EYRdmiZ7@2ʲ"8\P*^xz+H ~A' ѷ] |\M 8I@44PGGV14 !")=LA?%!d֙ IJ3 l 8MYNJK * UkpMn$. o,?IZ; zkƮTWymepOёڶ0C!|5mHN6.|kPa΢*硾hAcv=pwC)Ď@W ^<x@8Of]:*CƼGʑFN=E'I9kLj[>8dQ2_5e E"=KVd@_{q\̍m9 M}e#LF~=4U<Z*tW|| >@-B̾' i@$=*KDB( 3( Ap5#6Ϛhfk!8)}McsGLmZChAH<kpT:ic_V &&T1լQBnZ*wpKAm Zz%qpY<XPz:GImLs8ǫШEMI5/2!Ėu{zyeO+ccc1a5 <6Bb.-<*8s0\<I]x\˃\8 $Ϫ:I.&Ha8G!oB8VZ? u$>i'F(iqlrHΞ WQzk΄/7s\͔ҶO-̱I[8O6Hj" oi1Ew s|ZWdPaH}$,qFSmG3uOIP@o>Zs% hƫ~.,tdсD״BcPq>%iwIZ0L?doH$גx=!m0\7I*ӏKhkЇt8|*6V[?tS 829pW701N$ m2F QU^ݰ:W{ &5 e(}IN@p?KPq'̎jِؾV@E mgzF#"4X |m̧Gth5Gj*ibIL{؀io&i?hHL Ң_ G̾|eD=-{CDʴUP:j$&B|ִ#?"ՒF+_;n,SQu=cD2X˅("=4WZF1|?gm˧a3FȦ4a@(dnz"q|^E\l/q;D4Jo0_AMmw#x]W(Ɖ (z"sU^bfcn*%70ü7K\ iJI^4%K#̄Iс?DhHqoϊ r"1 c :tIcCZ.9k)$<~3lۉ]Fʕ҈cSȠj̾YOLJ#)0َ4glд2#u+ kB {ȞBTRi^u- AU8|\J uӥ \u=S-+쑣M\@U-,t-b38T:jZYG? $ZIOxp:J"xxbf|"6G. %bx{'..mǖ/-3n$.4[aD@l2t󋨸Z*h3)OOˆZ ]Aj4&:7͋LȚZ[]zHol-GhMC!cxE<-c>=ގ :.i#*CHBk֤_YWv> u+m5,".֊rftwLac0XsX&-ilr9ÈJ ScIppeDѮu*")Ž@+ȃ\*h\&hp`J/q^V, xY˝ |uZ .Zަ$+ƇV$8jKeGDI 9jĩx?C)RVQ=ϒFƗB`w[巪9/+J~!YLn\nibGHM:5J֟2BhD 6>YHRʢt҄@"kwt^D1ŭ=W>Msr6Vn266 SR +\]D$yd;q7ײ{\[W;Vʋ.dA[zGK>I-I^#2ޚVSҫ!/3ׇ31퉍զVѭtmr{1lMAPΕTK$t3zeqFO&ˑ4خ#kz[#c|%k0=D:23㹈cDot}xGĊO3#{ZKC cih# fW׵tc oK XX@#JQm z@4i GCyޘXIh#gG,ρ0<ylm|}44PUY,e>b@k\M(U'MM*ʄTDRG49#"Gkzkäu0#6#I!FcNc/75êd ZƜh*lakLdu85 Y(:Ch 08'œiO;~9t {f%"/,":!--ҧ=*˂;{w2w08Z\N A+buYd\ʶG7x+[g Iq9t"g3 л3  JQ厹k]<{^"( _֊7݇q36):z BxzTtR6G5oXǀ( 8Blw5ّ3A1i7p#2żhxy~sO62O&#3/-_^3q;̍q`Zf`iF8V.$e{GI$I#s=q'+WI$|={KĹsI.;5\ {fHh<`>/M߳Vu[ceĚNŤ;Zf?lDr@.qWu*}\K]7c;Gnu^77Yj?e{Q;d1esc/tΙݭxk0׭rKi(+ݱs>^o#M~IoT" Ŧזgq㟜x; hs ~־uG}f^u ]k,4zSogے΍2)֐Xb/h# GMyΚg1DO3nP+wvz:v[l=җm/nVb_yk%m'ds mZ:K>kGGNw+- 6M0i ˆѕqCg/qѭ]:+hGGxG+zL/%R߸qu;Msh=kbo+Q[62ϣs77墀G\xq4~Z%Ζz/Tu_Mj&ON U8:%Zlgicki,tSG$2FC>'95i-I409m~lЋ]T͝W /ke6Hg\A(csWG#jEewa}lmsVu7c]P",VwLœ\:~&O-qk;K+S! d'=E#K$5cH fW \o̢ 'r6WP]Koq5]V=/woIe?TA'A95y&=R\|/'!uiH2{` 4.K 8M:XqgՓ0n-; ? ƃ]kOPAk:<-=9 ,r+n' G$PVon#kwBarowpO!qik\>h@qזS޾Fu}us[q,VK-cZ+N >@5yMiJz>56OΟReW O7ye-eGsOYXz{۾Ǻ6No'113CqcX|EpZ[/poW:o ˸}Q ]d3C6x/Arspoc^iqpAAⶌч%gm<-0jVuմN̵A2<4S| m5ݍ`~״1H܃,xdsW[ [,đ#[:r.2wY@={= qxZo1Fi[v2_Vf喇ܺH06(K[+"$]K- f^O]o1[8`Y*JcmnV\&æyǴ0#uVj$5k5p^gt-HkX X$Qkq4*_kl]>CI$ݏ0ZdsBX.ZV7 q;30k/kfl>&̀0[Z֎G~Hke8xWX[qQ؊XeΥڵtWѺH2 dm΋&")k(_e~y|1Q5рƆs.r2\>Y{Eյ>MzC;TeګH@?BK@#|fmjF]Oi1a AqWWrTEI1CBW,ņj'^]]GYr3 !^\ޙbqi}H W,펇j-`M!8 Nd{l3ZeXAepV ~lwFjhާv;5n/n/-cx+2MGaJ91~>k[{]dbӦ [`ח5h%[rx//ZAj56y7維{i'P֧Is%/#lobFW0aml%s*]{_+LW խbe;K{:Wu68n-<4%Ok_[O%Ԟs 5%Z^+[nᶙL}*{=Bg>8#x37,3"U=dt$$͝[n@Gh:wg6!R䲝IaSXm/n[{.[y#,Uk'lL֖v7>'6ld~h,&иǂ˳ u,wB/(L&s- YLmx@M n OZ0:9-v>J).GHQOcx6>]jV[܍| !::;Wj[<[13ll&Z0ٙeY$T/ͮK {2|1S3ng|VMW׏gwHuVұ| Kfq,ּ1t<:U>vLf(S=[6ڒyon A,no2I=}Pagsw,+;lKn"&z\z(JMgq/nt.^tm,;X2x>ޜk\-A-k .}·Wm,̸H8ޘnpaÉX -7=,띂ҡsc׷g~(krlkX)-cI/ކ.==i6\vB6*fXq2%w&:kh˙VFǬsdtF1;Rb_]~)eO5Ⱥ:G2-s] ,ƑӿUik6YG%խo 92u4-p5w!c,oqxh.,bhe̼^x44.EZ5ɰ7XY5m:{,04%ɛZ9-ְ5hXȶOr>GG +,>X%ÜcX@̙_%nEZ'2 xrϻ|ds߉h|<1`:7QIm]#, f&kuyN{#3w{%D㱯-}۞I29ˌΣ9w7 M:#gvfXY嵻:s4Lu#P峳svyE21m}sy+frwl(xGUe5WpMxsgeqqg]Ķ(^z^A5[,,_[b0ٌ~ORn'3X_y}͆v,Gg8\ ĸ7iY\a N.5a-܎Ⱥ K8mf4,&m#-IXA3]tΞ` ei3l'<طV>C.q[b-s[oe!K~K>5,s\Z3+"`uVM஄L 2QvB_-tъA+5f(7ssqo~$%q<17?\|-lɸW^_I$2;-{>#cx}kP 4Kwcs rYɦbnai^r&au္= 3R}ty%%h<^NM?#˲|ݝK_qy3Go!ǸF\HoX8d&2+!Y}r\5h$LJ)`u /P*X^;cw<Ů6ʐt|Vֆ.K e&[Ka7WR>K,L؝y+,cȣDRΛ&I>lv^X4'`\Ko\$4VXx;2U۶b 9\n݅۹[-t_W~=1O5ޯch)%Ǚ)Mm\s O<}d6yVc@.g|lMq/$ nw_d.nFG omqvvW- e:F\s $,59#-!fKlZnx ZP $,f1,n\#{OOjl6{P֎f/!+f^[Hy7ۧG=E7-p촺 KN˙ wmn.bI ғ1asV:6rGyx Ax1x,NQo,moGR#*<##{){-φWIn0* ?cܬaoy27浖s4VW1I oIHRAy|^'Xᤷen88Z .ii k ^ DlijRnb }Pi9LA=|Gò/#Y^0źZC2ֶ9#|2\:)2`5ս1weRFmc˜c[evv ܄Bbxٶ^O3^>Z|7E܋\|ثϕ/gk8hMau͐z{u]MkF,\ycn0flEhSq}ط ~S1mH/\*\xmߨmcdìeo|_swls7ىv$vsF%g\1^85=FaX~$ֆኸc2lNOC3 ^:E zExIz9yɸ\9"t3%Q2 oi#bJ;K9e('0FOOP#<0yp˫k+1?Tz1v>N6`jzcZEGQS2 -Rj\}S(el=pYKq0th:]qk s%{"{MGdN2N4S *ϙuOqv9]op,W/X_e,}h -:z}E7ԝWI$9Eϔ9A5{H"Ԟ]33PI[&c%kMmmm;U4V6d;ͭdvO5ds ouYB R%R^΂:z"Џ]lw 5l.{1\6>4]6(VQP%s(EM!atLsABtD-wK(Cx5PG=^jSd]flq\olůۛw7Mx\Pgdϴmk$!1qszE:{rvIeH7E#ΐȜp%s\_oȲ^Κ+Yc{|=gһ[6KG;-Ok8ss9ϣQ@c1:COhtCsIpSjMA+9]tx7cVbG&H!uEd侹IO6HqEab: .I]o+#ct4 55 G3H {Apjy.6hoF\R7G5qN|}f9 M xpש ZVbkkc,#=\PV)-z6 ɮ,}(:UdVumɮ&  4ٝ%\-,l$l6C%vu6 qtGY{;21^ .dqmջ|P3"{/԰s i`--\_64Uft;Kx>Vsdp-X:H+-:&o cdCdX@yZ^CO]\1G գb3K!'Km?-AktILXcsX<xJtuwybKoWW~|t7g "XM4GN؝!f5];v5qW2иakRb{ sY#&g6-{O0gBYx٘Z[_{\Y$H<ǀ.3n3\:x-ŐFIWqwAhX͘2kD" kd2h.=sKOi<H$Ta8fS&lב7>L-YdgLvmk (jmYd1eȔ ƹluuY *c0)]],al{# cm.Np2;,hehkAS!o#:@i>O"Uӟ*#kYR6hg870TIa͛ȼvʓpH@m(pX qs:!^(^b9p}g2;Q#E.4VАK PRgXHXֺnsZ@NhjUi%- >7tM#$Q+H Klد-,ns$ {xr84i$iC_Bi4ic' {#&F"#TY_GwvK\.,it|p7s> _'t츾շ^3COխ#ck&8fkqy*[]o {yn$ k#7K<&dbmU]ev{op>ُGpEc51=|pTu5Ǫ#@DUdbQWL^.铤CVxVߐ$B*6inG<;8yFuRQr-OIaHnCF[ cn`#-kb&yUl?ւAKAp->UNtj97_%(dGux*,a}e6ѬlR7GYs!s=:ɪP[6[b90'确69씘G]IC^Tp5OVF W. d29uKo|r3mh<+lgZ齃2CawD~x.s =U:@%\|1 .l, &F# sªoD¤S@xc=,>۪9.#/GG j\׆Jqwᮂ'̕`19 2:zOȾ7[-.DwwMt}ҚtD`:V:6Wxᣉ1+\At/̞'@|[[q&5#*yUS{6epmRAt'Nn%-B8gtWVuB`@_3{-ssoS}+C3 BXCdddF#25-wH=$6ksj_eiu!HN=Cs잺 syWyzcDHΈoTM6:\z䰅Q flpuqqc^E)^&:f?kmI0T*8-54Zkች&HâǭEAF}>Au@qs}2H!󤜆lA a/2 p%ޞ %m ́Ѻ;Αg Z9U=J!ZqrYvKLl>l$c(48gq3y.np%ӝrK(p\,NoǸGRB#&. m #RvsiPTetkJرllf2s_1h0\ue`Ú{[ֺF$bR+w9\2b2@_ 7ut4S IkCcc,dnzh=1JW`i PpZ Z*iŠxGٰgd086:o'K# a7RKҹ%͐^˝u8ry== FPI8oKO hqBJ0t:I*ٌ]#֎xMi[):(#{t-gY2?Ġp CZ]c'%Λ" Z6zO1i$t/`R׆¼ 8cfƸS5 t3gX,,Z\ ]uk3GTSPҢQ®ˑVRȚu6:='9"6g>&:n!as . c d$t-to%0*8QEƵŽ!.sjH&G e0B%#q{}57 \E [-mͼͤ wCkEF;.t<$ "R޸.lG.<9^&t4G$]%ŮGt֤TRSdFcly$fa$,q\[^xNU\mf=2!5w+ૹV1Uq,,xVB޸] iszFk"{m$qU.m#!tǧ߅%嵊HKH_E |ַ@hc^^OOHh͸wák8k8zkO oā1>Ɛ\ښ֜ ͳkknZI#Tc{fJ`s:,9=\+D&l}AX| V|d5*+<4^ִI)\ׇVVzIyDuϓΈ)x@xqiAs -.|NQ,|Cڞ#47$ E|GXۏ|QW']]"6׉Gf ,NQ kcp&G<4GOk2\=t5. 2.%IxKȈ4ѽoSA}K#o!$o 5$R"Pmq&^[yꖳQsۛc zx7+#ec'Hy-i/" Kj~pָ~;ͣ8xdi'Tsd6<,mzCUN8}%fyU _JΚke.f-s x*K&$<=19:Zr|TLL1)R9=6>"ޞ*H 4~\lZ\z$$@x誙J<cu\:]%KOR8M,app.wVx'd1:>k KS@\ zHU!ݺG>8{ˈ |$Ez!{qg7i{ y{Cx W88%&H-&rU缹jΰM^ZhE]•Vw-GR'Dd -o0|Wpc8x i-!# #Aqm"idn ̍C0s$a5oeM@T\@CAk-tPuZzj>?RJuZy r\yyy.yJ}!JekҮ}/ xSҺ$_C $2(%8i|H1{hJ)G$964{kXƴ9q(Wݗs1[2<ιuYllNmn,r6̞" fϊ7:7'~/u\&wv/-U{_ᙊ{6lymg]fqp۲h--65D{KX{yaZEyἶ׻Ûމ&iN᠒6 ,vy gtDO#Zkwn>uΞHkmc;woW1qj}kA ;J˦\& K?#]m$kZZǺ{YXzm۬%t-[ϒ_6F6k{%zZ#7tseK} r߶ݛ;ڞÉܭc/R4۬~/X&_Kd%=w!_.ܹr jz[mƠ{}6 Y̞Z9Kabnm.qh4Eki7OOw|Ohдk566xL*K0[;]dzY|Ɛ܁ꑍA&W={vRC KkkFC~.!ui}}KM7ߧqz.p.bgo{ur n3%mw|a1iԳHqZKMjat.5xF}!{9{f{XF\\E7BnŤ't7m4-$dł+k<-k%WyZg[Xfypٜ_M+z1WQ xw UԧSG6"o=O.L=QM'W]{5e{GX_V^:ݜ_]5,4u#"S≜nn$\v& : C$&Y.ӽsPg4ΧJ( u;2F8qͽm$<(:u.jm2ֺbsOkl<&]2d84D&NWhLgIkL>?eu{1>mMŬxmMH93&B\hm['5lU\]>Z} sh=4]MaksV.K#֓c?^\8\JI$Ā V-+ ,s/lFX(ѬsG'cW::ZKZ%egdWVqYsl2k ZQA*8y*HА[=C8+lyuAIσ%: y2) =Ulom.3]3v;e[Km;/=7t Mab ņgu>L&*8_p+$QC [pÛXKDFkH y,ڻ[XGe =ECsYX:h e277P[b"%RN6KfUi21:L-9nJli2^3Y\͎{tWMfYsz',w\ -\`siJűDR@#(o\o6`t@W6Lxm;7f|K;qXiպ'mngR76 {K|˫9 lms(bV]=vWSKHqc]i;\|x%#kdHI*~Z ;̔tҠ(u#c/  cP9Gnet;]Z>6뫛-hmrmsyb]O:Pֹ8 9=vזU7oc-76sGg91pkp˳tۻ\>+\hż0 HHR )V?J }T.oqoC5ú: h%Xvo!$&V8EŨ Ll#{d0-ԭ{'s?+4Mw+ᰳ؇:!7+on@k\t;fyʝԬ\^evHu[Xav7S㻵Ws1 Vdm\ٜx/-˧3L Cl3xvZjIw嘣+/.MuhGqeYb=;ZacAӷP 4 }Sd[i6+<ꏮ8a= .޿Ry㛪-639j,n38w mpi:ip"e7VP){LK_-{\2n~f* {.12輻/zLiO_4L|ӷZZ5=$-4i.!&c}k!"`KE#u&,喦\Hز{5lrs#t9iMf[L_[f{B jAy}ի36x];d27G-C##ޑM;syy2Q86[h?u%!5YM~t[v7 caes&0m%NyO#m2RAu9FXX6[{A-@}b,q}]ynǙ 2GP8$#W+Hl I_[v乩|Tkjzy }/aE5cVeI̺v&cb{bgi:cU^܋Ҹ-MQ-Lږ<-nmlͷW\   <첇I⤲tNR[^Sl }z  lG)m/k{xw@v_qq,q1{gԐj ɸ k&QEqz_e/!N!ءy=YD]EC%/+#rdWt/yI:\*.Fʌ}K ^Cu {\vfZ{Yt\ h4q%; 1xkOVux'!A9'!P+LկXND_AYa,%Ii=GR@з:>qOFMdwN0meG9swU\/%4Mq7ݤ /aKwgi-ۚHE &$sv[Ǐoےm:Kck$WLYQĕ !Ӹz / WN~7Pm3Z Z6[;Y%.]r.kKvsG)}bt3yZ\5?ZhM`i_&)6v"hk<+KkS<칸=GЬ_ K/16r5oYm~vmY485 s^I;qYil0ZM3K> ?/lv=E̲V_ܒQ|3\eC]xs >O-Vf6@h8>G nO|s%v_'y`Am3ܱHpKg^d`e()ZzxuV V~6 |{'`g_HOI Z )! }X2F&7_m02 ]akιu&pF;Qafnqֶ6Cki;ݿgXͲczH'݌oX T%oj pw.;{#^6YZ/dGH-j95E g0\2S$A8P:O2@T}2{q}cYY~Z,rZkt&[){s.9/2q,|esVՁ7ie!y,,ᑱ4ձiFA}jozST YˈabqN\Zdr>/ )^+k= ݜ_0ded] Q?pwKm 5Һ1Y]otoﲑ-m쌙 Mpi!ff19 z/K'\&%դ{u8=4p즜{{X$sqsXef|Y۶hWQy[,֔j}oҹ A|/yCil4 E=Gcl8 CY'fB Vs8'!P˛+g5ςkM pCKkȬݑCs=rd1"NאַGH/[j K "5 acξ!]]cfco1Qskڶ'CKw{٘ۼ9R]Iygp. 2fS!fVg{t6{Ʋ]sI${C {.fd.GCQ =5Xdz\}T=kGQeq;gikr-5&'2|k=,mj)ZsEe̽#+i}Z٦SN亝zWEG~\ۗ[[]2wrVq4%เSkɮ.,eɈ m(WL&IψOO%5Ꜧs7rxصFK&ecm∱ZW'#͐ꡧSE|v[cˉkn%0Tn q|=*i\c<~ڊڶݙ)Ӌ W3{YZ=jH.2N]Pʻ{kµ<5/褆5rAO>_ "w$q(ިn:6S-tl961FAZQKQ \45 XS_b.c'uՋwK o  X? Hduc..na7[#Cc2`>i \W4Zn Vb%b,y=q5It Oh %-۬mdFķе=m}&e.on>I[\ĠiL PtS%dӖ̊R[<\]@ALe0ëxrz 1#Cx]pր絭hZy /$K:gF[:.iAy$yMt[cEIJBK?nc'tmм0%':hHel|%d{Z6ό;~Hu4Nyu su6@nqwFB犀KK<(Jܦ.nQѶᛑsՖ [RH8ɚKO:]XZW[BqiքT-V i4,|QNDGK=~`q(id7^廖OCqdd>lˡ}?H"s֏Dɻ_m c#C]!4oIg틅Lxg3o!1\[0(!dq=MKh@ ^Ewos zb[.|gmI .1/0KrXPVsmXW] Nk^vDR2YNx~̵aUдӊpOO$TxG)A"j[< _3t!)̍>>3*ykĻ&^)Ѳ[>;% XGN>[ʦF*oymek'I$w0:X*Ze|%KbtM ꩭ mx:?<sGGE#Z.I4 OSL|цHely*C@ ~)FztMsX^^H h(\5oIA-.!ǪI5d4S!:1ZKD{xIV=ÈpB:9B:0Syt-ozA-4Yx2w,t2Qlp7uã1t4<a//knagִ\[REC+"̝؛Y:HsD[QRWtFy\`q5LKhzh*}V^_edR6u59=0]+dCG]_C1ۦsη6",iuS)ck\69#0yq=Qh-zLlkc== .PX#uBM5%G Y{p5"ȯ%4Gs)HH'4T*=hx"X72 @礽C၅ͯ9ƇYVEp6\X9}OCWZG7U9[IoY3#_y֕Uc$dc>zނljC3V.-oT4Qshy#6^)9ԧ:t5'2-acZUh'==€5"WC#&?4 @,cFj̎{cwCXe.smsKKMyHH%'&_Bߣ¾ C^4=oaVuyr8*CJ SK :j:K-k4xU\Rb+y%ke.l 99AO_70"tucաzΕR97-p5O:qW@O67;89Ԩq kA)Zsś&V h^n.adGjI%st13O "*ƽ.<ɨjx> ܽp/wTT X&G[mYqgu9&5o*@cpc.%o+GT|ױ-qs(]@B#D^ {z UR:L_rϡ_~e\~TW_^Տ]7}tW௼5rm<ӣ鯭tU{Ծ*"""""""""""""""""""""""""""""""""""""""""""""""""/C c?^VͺM[Uox\kx/q_XiGﵮsM92 Kw5wr9~U4}̈́PB>Ao#̅ݝwAi [sXCyam]X72^j6KԶxGCh MQo9:=luej C%7g4Y+]lsD*96 #3×@Km#`s̕ٴ zO^k{ъSe2OڍgB|m鈼o.a{-̱Connv[Bg}..lcgn>f֮Ӛjvd4։2%i~Z>7YwuCR>(k9V8Tp==N k3ѝ6M.-$Wk]2OigaqO{ !>:r56WZnԚWn kTjGP$l޷h3M5ĎydWI^sK+Wk-]'֧Uf7Y}G2J6)hu(eMkh`v{ ?'ZR6k TwU8IoL_1wacqpK4=1>Wigy+ڵ9q kZ2W,lq[ڍjoX^cddr9LՖ7|JM8{w;U\nx|mp,2^b;^[sc-|o&9X 9]cn_iy3\GS\5sZ]m;]ӿZ >kHܭ/1<^W5ŎB>7 7p/Opeݩw{}ܱ+o|4Qj\7S9ʲNE;$kcoZ/7[L2HyOc9^{G훺khy5[Bmt&=pGBsk-G;ݷμMc3髻8pV_PH c0!DԻ=۾6DDȭ,lԚ5ZBO_8sf_T<A&d'~ZKcELV>9c{9Y$r0cs x#c79F=a-s湮 DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDAGqDsxJPG΅6Fl;i1y{;t0uӗ6Tۻ{dy|e'-|𼈞$cccwlg3va ^fzƴApo$wa1U=;? v\lΎF,.wT`rq[ZM.OMKm)վ[緺9ï_nn6|y9 a{x> Iy}37ڣ]w9K{ܤ3}AiYfdnUp -`k֣^du3k[]Qj.n[o'e3k3æI( 0¡|gLNUu v[ԙ0 mP"oI*A<&Mo5;㭴R ^8Z2o<yX_tgd\BD9o/aie}Յ}K:C֑yuOssV<(H~ޖVj'LucF]]KN6dsgeI-n.iy4sOJ|2 ;ih5AfBqX4]O[Gp,.Li4r "+ q#pFPZG s'<9WVO)<7o&m=em!dmyY?-!R akxl-P`% /ד/ė˜~u1k{;icwGgEdar22f^2Kfkϲq{K슰3kIRdByuV9lJy%ye4йΆe7˔dsFX'VN{IVQKk5, %#qtvpKnb1qy+w`ŌW1e;lZ\2GOeO4ru @M|}%͠szAA ^\K#nݗnwS@T>a!sKZBCZ7Ƶ[lRh䭝BȷXC0 LSGm2rI.>ٗ_c',mn!B>).$-dmxqrifm?>FK_l_Q,&BK'1h88Uyb|K$q4XRGSO?@5YU0ylT7yܕN^enQK=ՔTk\xG`FG(րIe3-mY!k2\|Ή2F:Xg3OMs٫{*+? m̠oJ2໬]qi+$d8>wӉHkEc3Tj|][ wNu.;25\{e8~k6X'3;,l#edk:w^FAav';wqq\u@]? K_i, y6㮮q}붶q% IZ6KW[;ۣ8ssV9˜20^O3l d5i`qXLdmnIͭcaepV7nkakA-5GL]L@+iݶ8$9|Ϩ%kmZ+ZqD29sso#Y+hwWW79:C}%I%mܗatP7p6-r=zIok.ivZb1dԺvkfC(l\fGUJ\^^ç蜲J_,h6{גM`&['D6 }=R>GC‚YwfG'ᴾ{4e5ԙXRlψ9,l qm6YMguuF^X坮 -x!'k #c9J5͍b L=QbZ3َ#ƫTv_7``pf&DeB& y}Dϒ(hcZ]..4X_d09~ vAo|z+wn׉"|VMR84ؤ1Ro^34?7ڷ>Xߟmv.,%:mpyTk;ιԙi.$|nlݲK1gH֫&6hxyq9&mguYю}<8滥ÂMeQ{eYj;h["ysn3o}d 5`]>Wh ^/ }K#}u51Q,6 &y/m:~3 8p펜w洖"$}DzLh[ )x$qyפm1EZ>VVWVBoem{|b1HoIw/iX5ƁۦaLD9,lG6_Z!"ڭPL'R;Y_f_\1ŚfEjͬa34E톒A8֢unZ5%RfZlx跎I!'[0 j i52[,eu16F,~oecDg69[uliҺR_d/l Qsf-QA{ mVoQ$ $~5o,cs6zN/\̜Z&Əi'H2Ln,uwYosqqJXA(p[==Q&P㦹KVVcecfG@\g{+^;c`q9{$ ڙf'[N\1ek95F5{3ոm#nY1]-cDs}ˀuM@7:L|w~kaeɔL\HhYUooL1M y̓$ldBݍpscwW%7Sb.#{;'d٬,0$pᬥ .glfi гf]t,Il#h{jh\//6,&DLO5/Ilv{܅7 ֭wy6L..&WO ցSEZ>v .W|wϧ.|t-d,f|npY"q \Mq5ygwوO\Tx|jsxYkm2WhK[9溸oUEjZj |\_cv7~qR( `:]}К[8h]Wy.JKk 8ݿ 2QY: }nf5czK*s-1uw}`tN[nnGuέ X޻Zvƹа"v\b+7n2+&Zl"Ob._9v4Ǖ}м{ %?\ZSG4{PŮ '!^NC\ɒ2ZK@ȳDdu ۗgZ-zVo%8+R_kwxXc:׬(]_]@5iEsfq]4iwMj'j Is%3BbˆO91&"ZQX˷2bꉷ2s+_彐$ F 9ω> =.,^16v̭՞o#px0W9 -V0:ՑvIednhfGSk_R**r i.JZ籸\mtvwZ\O 9M=5Y<8"bl㊚;P;֙6F~e=U(8k/p3c4.S;ǘʼn}JI-p$uRE^Zܷ% Nk vӹux.-sf_ B>?`]zc5g\2^ BKmoC'MQlcv-ݐxki?kCIʴ4>>%٬./JYe2xj-k %{<`7%Lz h n 7G5eƍ!8n=(ME8q%Ğ<]i\Z{=GLsWQ\c/lɶ.^I1`&X!(esY/cmѸ894pAw u4[_1 7ps8Ifo#[X ġP\2k@-i 'a{.#1?^1oPW<d\# -xoI>+\Y]Qu_7itw2,尶{$l-gDc8 8F~4l˞.#"hkZLmCz:hښqϕ2* i C^ uOOSfY=}͛f2cF4gglauy-sh:jX,mfkoudn3^\˝a%WQbh;ˑdFWIHk5HZSN[]eՄ6[BI%s,?lc|TT;kux[nD-\99:Fyt*@V=t2*1kzKPP>O;x|7"1o*+7n&j'gHΧ(Qq~N[15DD6Wkڸ0qgq-ZݒKCih$5%}U&Zx{=8/y .[[sd]$Ms`%TWt f-̱MH/&tf)pkmpg_~0_6?(J'#b8 g:oSW:.&d&G0ա_g¥hwo͐19+27 cq!d |6e1:Z֐<8k|ܛ.-Cp-kbcCKG@.'{˓=ķSd]sNM+lld18k@ E{3g"+]p>gKCč%5zr5;W&'`.̷sHE^A*;,eg.\-$9>c6?h#hnc&u5<jCj\[o@udݢDNLGC[V$ IQ@wր7GI B%/?YH g+mˋ])2{ :xE+cne:t129%[\JA ln1Z 5汷n>Kb-YgKI̒6f^>t7$FEg)-ccbhCOA|Z)N'5d5[ Nptm}txT>ӏj pX'o#x,gCuK% tѼ*iZU@oTF>VZ\* jʓUg'i'B1ѱ-/-o_hiN#ȒH]h.d9k!h7︙C8E45|aApڟM;5Ml|\],"'C#XYuy+LpJΦnfH]R~£^ֵ#:Mh^u!|dI!x+Q0\uA,pI<Z8ϥ_tRJ>\Uj6B@jN+-R%|r\ꛇ4ꑣyiRWPƽNi+ϒyo$W t6Ԟ~]9/pp *13{JD\ZH1.s5+YdRAy@.auŞQLT]WZT|&ys/Gs+",}[!nd&R,ctlHBZpR/mYHs{Z69!1R= pkPH' Z8u3c 29]${jji'/A428j_NB׼Zto&JCxD׷"먠_I_#dw\,q0=iw~Pr*ѼjZ+\:֐¿mK¼ɧ2SO!+¾*L+]cgZCMzK|/|[L69Ynck=JHAc_4Nd>e2d(A Aq&PoQ.hʪIsCdc$q\F4p< \J򢶽ѲݼG`K#Zh@3Ɯ&6ּTG#:K:{I5. WsX[c,|pIHp0֤҇ҭIc-lQ16xPIh2uÒc2J؋\86WW!5 sxԀCGkSO XZRW5{qH6@jz$5Gk[ xV Tx*V|ύNJ4<5Qc$uDqIsZPt4ПgS}ˤlm{"k)9j˶эItq1i c+%)44Se=XtHUp_,G199a Jc@REkFWU kcq.hy#C%K8PԏHT%;Akk d>|.Mdr8=¼5ռPbV!p >dnsG<)P^#dG/[dYCAO-Q-⬭ccIɕq\pY2J:I%#,a3H9"9p8 8McuzCp/O3-ookƃ@=Ӥ 5ȭrkY Q콝t:hq U-Ate餞ø8iRPI|GKI(fGM#M=51.tDM4R5I ]m!}H A ÍTyoGOLAau)JO2Aݪ iƜ %]7u=d8&'G9dhz08N`kJSǍ@z 浅: >1E3h$ci{=$Z^Ú⡧KjzC=\:G+=lz-㝷qE庍n|6IƊ}.- #dl6(tц4yD0i*UAh$kWz+8B0ShIq@WW:\ak3w#:D#ulha-z ⮌WTzc'.Byatṟ0jUc.Y,ᅮ sHC*xFBFz Ic #Ƣ)c뵤:;Z['C:(- ЎH6 mkBduI$pݓA&^Z S/h%TuE  okǃc V.G&_W9 n} ttxs$~Gtro6"]7S E>mQWAΩ#ki=3Y[[ 7Cq}9&{"Ii{5h.s 1V1:cJ2ړQxL wW6[ f2)/.epk#{=~,N" n 'vMb1Mvu6>$:e}]]\17Z! PbQH~OI{[tjLeVqx,ݮZ[[|l HKd_#{߿܎^nme.k1GJ^jl6D&_y{wq+<,h#` [ݻo x{^́pvG7t {f7 d"젷Iq\V;Ys[ݷwvem!&ո[_;/]go񘹙qqmdcƵ'!m[umi4^l p i sF c[ezYmTb,~>e2Vy_cyccKt}}ǻ7yo_ep1;ouric,89,e$/Y&PDRGKQ ffnwm.M97ٿbrOѸ@ ƽ=?MȷF v#ze/4K|Frk+)<]߱̂N5436[yQ)#_,]A5-sē/x~mŸi}iӬMOAҖ8V&l}G+q<ӱc חƷ~6s;{khӷHx,2j]3Ԑ6\[YC+y$ĀG峊3XrW,NK d@׀HoU 7_ӻ=3Hɂ _i4/PEc{{\4dZ _Eߵ^h/j 'r1 k35JY$X\~IVq;.G (22 W0FY8qнvtuMM!MM[ 6zw'ZRLj6n,f] $_@仸oNj}g45t9\k0{gik]0_rz~ْq4vY619{njm,[h`oE [^0 @w:מ5W;wgڞcn،1d] &9FGon X-kge&/mlͼ:7m;_MWUt_``mdVp{Xdjh#,6K |R+⑥ak"VYpޫ[{sI꽱ݝ5Z_Rb0-޾ү:(.#v<1izwܮuhһ7eZUgcz/?.XrxGg+XDs5]kT;\bd/ps+nbicXk>3߼)tz)m5.o%Y Ml&y%sk+X&KݛtoMk6H`2_Hl]I<>;ŞB,6 ,c$1tri<j鷏Gm#9HtcOޮnfm-/CQdoYsq,N,sA$0V4J]CvǤ{<vA_t|fKa6zK)1˗9LdTFO-:,VV],Q<,L2NκVhߟn[>7?cV:[Jͧ0ylYm/c+m:VE6o*#';6[;rS>3vluѳnNCMj+n&N.[m3㕖^T419oY:̍trѼZ?if{Wl t.jyrx'\Ftk}6!=md˔%{wamiqwiUqWsd"ne8k 7isY>6y'*\5|p..c4k-ѿܥ=ZL8{vH,nE<镖P \_\MSd=MoiƁ\'kgVY=}ZYhEY;' wf2Y \6>g?] #KWr6vzMɽic+Rh,ƖӯӘJLVnKVK"n."y$,v\C*XlDCc {j;%4^} ڶ]?'u-An2o)Z/}7!~[i]OR_WuCM̱im#a1YJVLP؆no_pm>>OR[c+LFiqkGcbq ū,Fu՟[KkX.X 1Fථ/h:M^6sw|En.+# ۭa:{8\9}i-5ck ` 뒥eso ,{Onչy4U}5TNi$5{ꓠ^ ٵ6slړH$GNkyfЗ;lgܝs6ۙ%G ?:Y&u:{wM\\X"""dX\_ wv̦2{ :Vk{c{k$W6v1HױA fs^9ikK\PZE vG!o1yLu:{+ Y5ݕ⸵쑎k _G݁ rL.Wv -D[KAARbmn2w3MiW'D+~k{b|UhC6vO{pLFwkKt4+LVVaf7 qɩ-o\×kKt;/h!_mHiMϾnG YFdnFe]]yvy E.-[.ONu_WAGC3Cs'ZQzk׻xgpq۩#I;F$n^Ͱ#@l&"qv~t=%10 ԐXgqG=`>&VG{ıJ)??{x#_(]vŽ=k덻ޭyr߇ /p'"`%gXimū"iuc""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""'+m͵77V0uZ\,m{eHE%5𗇶o[GS\ڃc%yi5Ywe,6l84a!c^f)t b溶6/{fYI ?6762H޶=NgS\޶ޡNxd s,>-ajYf0YZI"6^I1qd젷3=?,629:Ɲ9Do+љ:v`|^=FZk $~6=EuCt\ZmMZ̚H^zH`.,|>IXXfjv~㗇%.ip Q!Omm-ʐ1& #]^HRPkZ*}J|*}oq[t3E&/6/.̣+.l3`&̎!r4\]ݱr͊ jWז3:$p3 w0!lF[r4:8b!ÒөˀW!;۫[VߓFC)EuWܾ2|lfYwi/W֔{,`t77ΌWF> w,~6ͦqVzYtZ_-7$`Z6R־/*C5Mkq,.6 31ۙ Op**PkI3Q :ɷPnm֕h}&qLkddok)}D$ìV7t]kGoLj|}͎>V kޓhh<#Y?S-+?w6nLctl6Ӛ\~: 2m|*[\C5_a,D %s:A-vP~6f۽'r7٬U֨L5dx6ᡡ7=>ԭ56 Qb%f6JIg"~69k]IԶMFf&Vh0IYG67*.+" GVh\ZOoGM R˚o+ ,7t=(7 ϞGYE:I%-TdtfBDokp7V&(-/m侺tkg|d@9"^E7؛ō'\g,-a>F #,QBkeύ%ً%3ն\ZYPjkrGEdY,e4դA, Ka]JE#lns]颼v4pXs֘[y#>l dc$>mG,~Kҏ6~~rV=qke1u3B8 q6qM5fZ}aLADG-62_p=1w1/s 9[acanm.Eck Vb2cNcǓ U2+Ο]]0Q[V)tevX>Yb. +<G9%KD6iQ#{tPc.-+KݒyؾۛHM Qj;=98q˧"]WMȑÍ+Y%cqYIm<mg=<0ZjmX[7MbM?}ҷV;$7|ǩ0jK%i\fc.3hۗ5~#  ꩮzkrqئsB-pϗθkI.A:{odxBɰ67Q:<ΣJQNJ-4222ց1cnXG1'nmmq7>mՃqr}aw$S+PA,RE,OFXiiOn0'1mhujNrG5l{'cq2ݥnTtև >iX[G뫨a7[c1E<ɼ꣜ׁ^mIM-%vMycGi1oZ#䞒C'ows&++躷\]Mf69yxA>\׻Ӿ{{1a^o?Umcu:81Ek\.tX.)w(b ^{7 O{YEnȃ0-,{/|.s%&P+qoaӷL֎A[Ż!΂{V>7=îPc3RQiвX7q < o֓$;:!,~s@hB]Sunpm7LG{-eq,h=#pŭ $7m 3dc}yy-Ox[gVIAp#^ )ɃB˫rVIg[)Yz\qiIfObl8rN* 8F_FǺ.XMӯ]m+=Ӯle--r \1GIc8up2ç/L]\2Ǎxt2][^[L:;(g4Vך[gt2K s-1 asu35a).- Ԛ@C6G$pYJmlakFI,8#|VVW&Z*6OFk lgꙌdSB˛xbn h'ڭz]VlSrָlT/JJ:yG%5nw[HApcɁN.I$kO;g0kL⻃"Xa˷k>c*긁Z56YtfO3X|nBfP[cO[[-lQHq v5kCև޷HoQ[5srg0LN }~{B xPy`] F#X5-%co;Ԛ?Qt|V%+[+amc}gr譾p(u˘zEW!#mS74{a[Y3l A6Sg1fiZLMԷvfo16x4n7J܄]؉ݎ[Y fPh\M[K,ϜZvݹy%l/]H>>FWh>,"% }[ݵwB]N_cnu/&m֮m$ƜtXeY:_!#5Lφb͘^H #jZNV<ⶾ|C\yxAWG&ьh{\1Qqӵ!ĉG<1RIO+C3dKxTQÝ~Mh o366W9 )w<#03]/z@ \R//AsKdW C,mO(> g6_Sjn,cwKgyh,qف, H~"r,.m2ͬl}EݵZFG]N^ Apkm6v:+K PȮwcԑ\Y$0M*IX4Eas2c뙙,l=#JSUSˠD2)3Pc ñۆc 62_t[7ўQJ鲞7jɠ,d.u>-\$HT`4R@4ΜOuU]`ciC&-\L`%qZ%q$Tyzzc[\9&(0]G[Īd5ƇAkilǑ5Ⱥ+ ]kL~&ݶYۖ^7mv nB`I#GeX嶦q#!&1϶kO3d@eH5U Pg.z\IO  sֺ'ke~&vJYX;NuikEimkfp\xl pZi4[v"2F4X!|1y{!8:&2Y E<.Fk<ˈ./K.$̓:ebk\,W\M*6+Ddc"L*F$ԭ.pD.d#.#xelif_:Eda} uy-1Y6_MC_tH.c/cxT.:e) ݻ7rKV2c"-c"y=$ڢfIɾGI>J+$g6)#-he\OA%ѼtymnKFe2= ފxs0ML9&$^꜖B &E[FqӒ,=gY4%?"rW͛ huLP2ik47;LE;|.?% bQm,D=鑼*HVr 6F# -h{]P |AZ՝Xn#GDz#k9. fIeVBֺyƖ&N=FHws*N< w+jYx5K>@BֵB^^+] gy,!hwks s<|yL0!TF)ĸVQNiZV5wVӀXɠ(&d|r=^K)C\(چGKk`ۏlh$%~MLBwڴy3Ml:d=.?TJ:I*iSu x~j#5s-櫝, GK.%.28]Gˋh]FmkR7tW\">\8e!4uZ:J5:,UIY;ۤ]=\ <+JG|zMk¾m4nP;h >23+'Pp b%K<gtoh`cx\} S_ KkRkw#e\1Սƍ. QSN5$ӈk}C„~9,6PΡɑl}K2ifd\7[(M#=F|eL"9|L0 ١85ίIks~&q=~&94 )$|q[F'tx-{K7c[Bi@ [,^`|q[`1{d͊P8R.袆RhG}[FJ>7Q.AХT 8ӑ=DJE.;{+B- a!@! ]⬯7mӥs卌 |̊PK!-S"wh]7^u6 C&93Q4PԶ|#xAY\ﭰ:{(`t!.C'Mcll,t}Mk}R[6&=JAi񇎑%OL H4 О Kf +rn-55Uxnlo6x\X\cO!pSp=*Vs |kۃ5ͼ]1CpnǾ7Ӭ'b!k:粵g[ NqĨ1Vd̎!;2knHkpm\ZUFH}o En|>h{\lZQ^4R[]} dsϘ$&@=:Ӓː[rB:c|0{.< 8[_@@buSq6 $kK2[w1"{%+6!?hkEL@8 ƜyRKg;a}"Kg12GqlM.5Ub`e];̬ a{=i#(akqq#xG8$l zDs5!:O H4W/9 Ck~diqR_LXPo><269sa/./hC$BY@- G;a oպi렓)EK7PHq$}B*}fţbD l!.E,%UTPT0d2.sHFVp4L5{\"V $j9SœiSMA9sW%ѐ]S-Xpwy9Ԩn[GEb!RE Z=\ jn_ )ֵz*Ix 75MiYV.;^BSBzRncs.|޶\M 0utBiAܠy9hHQ"Bxs>*'IX]=̭ɣj Z Ng%sfH&~q!gAdԸRRZtOU&qQ.$TFziZƪG!d?ikǾxI=4!tYIe>GtWpiCbyFF#l^\c`'=> 7颱 pz%0222629uCc'ٯ颯mglr8[]Cz4W әV,dw7 =2:(DE9%w_!s\zxsоpB>7<4XP1{hE]BG[EjגZ>+^OhYCc#q!45E9)>#fmn{^zI${ˤqjx)#0H51Hy8UB@MOݫƜIsḧ́1k:\^]FV8q*,]ֲ#7"%_[+ kWFD!@hH.u -#8VZKjH:2G POªFpI.Od 8thY=4"U`1aϠ |*E#Qz@A^Ox7*oKpGeXhWޖp%ĐiZ,y!.7ɉߥZ:upU{z5{XEKHh<8 IGLR==EpX@x+"ɟ?;1ͳz"l!i!t~ÚC$4^ CZKB^qPr2hAw5}c-a'hi8D4`k"c%&F8Wro:*JAƽ& i>s#K x8hM:Apa?YI23˂4IAtR"GAYN !aoP#庎@:esd[#$M>_BgHc V:"˜YIZKP8Uv铯R|/ޞu?=rOe)%Q}﫣W~uǿչ~oM>8}q#WG?UC׽Mr""""""""""""""""""""""""""""""""""""""""""""k}ooxmW9ug37"[M)p>hSk,k|.ۓjqu1lMq$q>ܶ##VI_J1'\lng4Ec-8L /qufhE,M&:{zaiN/^>˲WZŎ޽Obsvftb!dM4>[ʹLז1X'f˩X뎞o$ۜG H*s&vWgwuFp=KڊͲg2 WmQ [*J[Z rcol_9|>omv=IvصEslgxD\8n՗rx:1iMkx׽w/IeFkprKg7OXڸX]Iv㕥ԗhw<6sss4vi'a6IfG$@I%U fn..% 74JPaϖY^ֵ@s=FW{T퍆]i [ 帼BL&f;؝-t@qWج5Kvb/iKXQ캇Թ{S ԛucmnot >1kH#tWx& 8RǮ"p^3[y2nJ긬tΏYd6h|ИPئm)X-}M~}ydKzg)i[K.WiMvBCawQ[KKnX{6*\DSM%ރ͇QX_<`Y]A#HC7+yd֞LL&i$ s.!Wn{lwbḌ6CD#Y.VlY/K٭H-dp..@@p-ӽȝ9ki^tŨԻmm-ok. ,om89!q|3J3G HŌTIvǾ  \J?l~{Pfthͦ{|+/l -h-ԳC0XIR: }Hf;qkomYkӽrEZF̮>x6Y4~=Say]5~"2>ZdvI ǎ6m~ɧY4b=vZːu6e1G &,tPth | GS跇3cs(ی&bA93+iu>ڹmΎۆXCɁkfq0.]f^+-[yA;4Oie9&OB{a.>Y2Y.G Dq8\ZVSRapq{$yٗ˸̦:^F kI]\i n#29qI^dgЂs.mN.]f1c 뛋 kw'C3#^Kfonn.cBo-wq=o+X"ad nh-*sk\H:[.ouiO('rN# d uj!ȵ/ p3[#qy'ZNG{[lsKj@bWh=-\7-9-D^{mnV&j-q:;;s5FL fCmlB^:GP4 Ŭm[B2 _ 'zs]CN"qwk;gjvZ\3Q]O9Xt &? K|ĝ@"׵[SjcRLW95J3/et,[#5Fw4>IIq$$J#\$q{Ĺq.s+>c'&c+uj'g2yl[#y#dw\^L%$[m{^ mր㴶^Pv;\V6sw;d'|\$oY}ܝoA SZ[;̰?5m<꾟_q^/LMZ)cXkǛ ɑZ;+f/{ė7gI'sw {68an*0x|KMKl]EĻruSNIGkos#4qYk-a u#;u }bgGAi^?uNn'ڇ%oѸjH&;8mh"s#q 4qEOV+o?\]mhIcʉӸ8nml47벖=YDbbO oDl4I\=vj%]e֕? g7EGQ3qx47֒D,si)@]'mК^h>p:=fW]uZ{u&Wq5qe*刼A dTRK-6tQ}+;_Et^ֺ+&fL&[0Xۜ/5W7Ԛָr+uEi{VwΧqC!tΰԚeAI}<qݰ445-]~%r6HdwYEz $W\mջ_V~;[Y߼~wUE0[zuVO;~f̄[[5 2ɆBym ~Te-`܎vdfjA.o7,m͎RjsmF2[S0+P>;)d1>rKbi!)W8ֆ]͙mi- 13i,kymY;y1BlfY_ݺVYmm仨d=ox/usw|~pm|_vpxllgx6,5IJx$q޺G<,ZúXZLwL`kOM6~ ~gu:FDo,Mt"Nnv'1o.qY^9hXﵮگw./Go5VؼZmnskp_ |6+4^dޡׂZfśl 8ηA,OI\sܱCOP^i>ԹݙIp@s{]f#-9|wNhBY@i|<{; vBrq;oиMblA7%,8{XjU֘nnht%qsm9^eh]FH4\%9|wzra[rZJlf3Xe1 #gj|2 LL|cb{d(P;>v`8,3V7]X]Ys_#q+&궹DLU&.lkdhZf1ìZLIiEzOݯ͹ju&љx6Xfg]˷ۈ~^ bXLu.k|n.njZl9m/,͙pL0LKH  Nlpq絕\$01h yxu뭭9MCQhm_EӚ{Ze}0[8>79%*+OE~=|5k 1[7WhLП'uՍ=M$66 gdm 0e1yh\o-ol xq}lv]{K#p[7]Uj5{/x挅m-Y'l.ێWm.b`7KIOcpe%M(xcls6~i7+Kb5x:h-CT!0[m^;+̕-Mݏm l'&Joa{m~Gtm# v-}!%;;8&p3eakqy'~q7ԣA.30QEَᣃ]=z[̥ް>r{~dX}¶hiWYg|u|UaDэ8yerחH'Dž ǀ5x >>a8}| h=f<lY;+k٧fRn~kw?#x:[ =՛Mh*F&bOw;kz g2 nded5R\G'WpoC{ٞ:Lkv/QՖhQ{=Egm-K eul{A{iyPG%Hx+{4j;l·]lU1iMKa,k-0{멭()油OcsZe0ֹE^Xg?nVܺx~=L.69khn{hn$Ja#8s[}[+Ο}Md >VˈeXa]I1JHgkbl&C3w,Ry] kZDeux؛ oWcS$5w::t4\KGj %RᖒXKsie8HZo46j<@yrt:M,PŴF5>cX0ۋM}d[|z .dv-`^f,1u#]k-I~n'O&ObmALc" #_Xpxha_׬{ۂd~:F޶F۶ f^y`TdqG<5/Pdm kKPk# i ˁZNZ<796t,N+A୛X<,7;k1Umȳu4 [WIu X_X"x{/{EMkU&Zg_3up+/ _h{%ywMHRq\jIu5h=]# tְ뜌vŝsk ηL9.qsIEg}^,?2鼛.`?;ZiGr*S398qѷk ҵGD¾+W2B +µNe{0Kkgc᭾";K cmsM;ͣkh+1I\0͏P鋹$ }ŎN;M5=ǘ0lr8WsZ2ZuZy=$%mϊg#c[_dB̸IK\$H&c\[Lr5sMyx .yr dlSi $":O'#&.Ti?_,aq2TQϾmv[I2qly[{iX!`z$n2o2z^M3ZgTP&_Kliw-k f=%3+{*:$9k_벚_l͵#Zj\q46;PƄZZ=ё ]Fd/'8Ǣ-\+q%dqM26T1ҴSfH^L; ę*}5}kK堖/bhsaZcEKS3bZ}V! ߬Aqz޲ZH kzky;InC=FzJHQ\˜֨AT4da avP\\F]olKӚdlK>)[NN+=\ԗv[nIe}щgyLW- E,Nkp6!'@p:}[GwZmY':M{ y]58+qohut}]b2UnnMdQŎ%k3Inm<7|Ʋ8?X]+qWOt[Y:}-K$/A礂HY9vZDm:s%/c6q69#{A.ZI4u%@Gtֲ_d-m7KlǥDҬז~m2z-r6n癝sGK`4E9]$&$0C!&E<6`tF sƾRJD%.v(29d{eqlM&2Pj)US߫q.57<-i=IiϹȈs[Yd0RTusp{ȶ^>qg"YR)tŵ'+aw $<#3鷬.!.@4B\YRFnH LDZ6G3dt,.!弆uQ1;u2mk/]qam77uCmGq" ?l#-i#I^˳ٝyweRtY/5e澾|xx1 |Eܗ}Z3ɓ qau ;]rA#U wrk~Y' q\DfI{(ݜ.~2{? 벚W ` 㙛}Z)dyIn-aY5"#ve괌gYXTƬ.j{>ݛvGqudMnՄG-2tG 97qZa5#Fq[+_=7 >oK+8bّHM)5_d۟1oF*eLH^_.7:8Eˡcn/]͝iܽNBkQuط[Miy.-q/ v]|-kV6]/vVƜ\v:U:hHsps =7])q zqEa4"վSmZ7+n'XJӴj)uauWMc 8i$eN76. hk Qh\a&-cQq[|#‹y7NusExm Kg}[Kw;.fM6IFC;^,6;NJൎ2eBѲe$3^|qe$eζ=ͼK.8iko}p 3q1\۽{I,.ĵ Tp08m=-qR?nuZm7sqs/4mcDf*ky X H޷K%:A. !G[cv,+-Eo%I#X҂\R}G39Mqu)_E-6\K⾺뎱 5 +uPc|[tk%qlPXKtg/chv[XMq Y#iajNDp0=^ۘD7c]uo$9.|ff k#pȬ;MM.L{k^;|n"\!K{H-"HlmHo_W)lج_e.ogAqkm(musp ڇMwb[+VF2E.et1d\)fٮcTqx[Cm㎅DuE. 8e4i8gf,嶷 { %ݤ;#gkv$+adysz _`qwVgr8gZeme 2e42_r ׶QK- yM=ېj!F > O+񅕽o}{l9K#-5s 0PNqW6l9nx2/6֎6y\F҆/oH& ^͕xn||ǾHati y$oBņMɏx[5+-M2r6Y ˲zsm`j*64٨o<@I#ҽۭI.в[g8J[W㣚kr]5S LZyu|d4Ě䮬l&߭ϕZ/'ug[Ђ=c6.|/auǖn ewoopddrԝgUN_ɲpm9\.wٺ hvﺍRpKͅcPo_rF˛KIKokIi+]:9|n7A9|K:Yy,Eۦ5:dVr4W۪vN[j}M/Aiر-GLU$Y6W12u5u\[|{M_q]N 蛛 ̅ ~|Ǽ=Σw_:S[5ܾl8C. kAe< Z3=Q <bN-{lfvԆ5Zo KDj̄QنH"ڛ;}ϫ-帒0ǩw{drۗs.mԘ 4棸vGqh&lk : OgaZ>&:09emg塲4FsIhx/B$wBẳJ c|A (iNF+=>#ÝhA܌$\el2}Ȳ-2" a"``5w:,[8Y [(g3L'my(SGO^IjM{.m;i&^Ki?r<_p.e7A| -GQ\g2OdVֲEćw#"="G 5Ʈ-(}|yӅ9 ]g߬j Gy|.1M?+qd$de;S8xBܜ(( yhi] .%<}|K+v}5*54Z>6GY\K-n)-;[M%/hz|+M)ךa,`ͺ  |Ne0=LF~/Ds $ Т[ۿ\厎a Œc|Kȣ=ҥMAP{$Pq4‹$8qlKOWvbqZ:fI}v.: w0va5GW&)e;ےjc쎚f]ė@Qc |o$1G|W/`@ik֒kBj%p'$O}K';rW\3` g>]Kr{$ :Vl9%:Co%ӥy6^\VW6_,"Vy .{kbLe҇Wi} x&[2VagɋotŽl"F"u(-ن;y.ʾ!!l]aPTpJ#WDZ KWiΛߩ?jcvNsf6"ɞo 4#..~.\LΗʓ|]qg5{%H( >n$ sIh5=. 5a^]9Ayώ(#mה.m@ qE{[nnkd+ƗyN.l25p#ag_a}Tc7F5ǒ͏Mldu^gqn' myeu9e _}l` >lX"뜽2J&&8AE= so^酳~DMa e o qX%ǝb/n$s𥥝7. /8 ய~տYlocu^2~gNLGH.KljǶ XC#Cm8UŮ`ƚl|]1 3?kT:>ub!"C,c %JhcYSGZ8PӁ5^:(!l{ZΙ|/KޘZJ;o,#:$JH_ 14T)RRbX6X6å.̒$3=C=^#H;xoHho0w8`udecen͎1^C%s*7% 8RmGWP Z<8<9EE,.<`dh 5 ~ZO=WQގ܎ Z6O wisq4P[<| JGL ,$HFhwKZZhyzyz6 呑Dȥ?:Ņǥ x>Ȋ$kng+<}ݻ-cw˹Y 2eΫ\sf)#I-yl"T L<<5Ni}CʔX-]{h%/(G9˖%75V0@I%"ZK`{Dn^\Z 6h$A 9Y%XVuK4T4JPǟ Sl ibc>p,y{0.wq^K  tx1TZ b?xӏX۩:p#,}ϙ8q y>ό•qT PI..5BfH:$s|QuÉ c[m+[ 2QQZ׃Bd=VIn%Q%=Gt9DoYup+^'+́c[n$$707 l$q <YXbGmâs"J\lXGx{[),lz}֔94Jp&y5_f("w dm\ˤ5Ұ ThVmt\^\Mguцq`.{GDKGD&Ww9LZ孌Yj<w+!ί CxU 뉭d=qy=E>Y*:zKZ^80a[0$Bx(b;WKΚ'Nsæe8+ v ctqA O&IxpxcJٟx$϶c5\bAwO5HG>T:9&e^ mtnJGL2FHw6x8o'XˣE+\1s$|Q/t6C@XRxxm  +V.d6GF i$k\7C@+cBB$qhi|kz(8u*+EHcow_L5-/:9J~uRMh(Hh9Hs{$./eU5Z¥:C|e ]yPRc#B裎w5%WW8ƣkZ^4i>+-j )-Bw9Du$. \ZVE05!H)ʼj*Wk⮝ls#ٸ/)· ^<9,_w=,`) ZM*8fW!a5oKAĐ A*'O.#*LeGyL?4#Vr5{ [{X*7:Cd'sW9"sZדW^<=NF.2G0;45s{ <x.izF`c` wBk % s:KClN$4&Ң*j@hQCZ@O:}k G>hNݼq11Đ* xv,{$c#I"kxJ S„TrT{ il<|P@-iܨ „8xJ8d8#+\X:C^<Ml F8>7,#z%ETk"1qkA8Q4Bz[BMB4_Zhs%.Q'CL}ۙ T =r5449q$ {NL*^IuYIoV}$o>iPȎ<Ǐ.. |J.Mk=GZ5 @$UF2Xms߇5Σ%Ʈ##0Q:8#旆>PY,. !*{$YDEdtc]8rUyc7ymwAut# "v7 |6gՁD68w8sMG0lY8uFXއ5a5m]uS[Ḟ8d Vi6WZI/O%򿩞cL 11q|v-tu\Uf+hs3l6!2IsxӝNikj5M||me$s%tq[7ckOjF#:,pZ ]HUXjBx=D|jcFgR9!2M+ uuAkQ"R"x{tgP$2$ǀAK^e>piO-5/׃(_8q ?FH>ݭNokKDNצ'䰗Ms$ydWJ8 bkX:hWR7]y'hYV!ihC s#' JbX[wk!ca-+ZOIio;I,{1H+X;W;/@"P&Ѓyӊu&F /O.!`#m %GYdY)V9H`8=cX^\*&ʥ}3ȣx!s[] I*|jPT{@}$`0ӂpa4ϴ \ӏO g,܅{Ճ\ $;R1kyy]4a1G EAh>IoF^uy.wюߢ6.YZ=Bl_G4ץ4@%ƜfKO.Jj_9k=_Ƽ\i#;䕭]+Zy k]k|)W>Q?;^WЯN+k:ew/wߒͺWXCuvKѸkK(Xdmc"4[I`w>\#˷ܸU4]r}Wv Wv{_ɽh-?qc.nfFI0Os%~gTC9et_^[=h}!sVbNNZWؿZഖLNZ97ڌ}CxGc L8)O:weGSrh_Sݞ{zW Z}w6oԱ[>ڿZų>E͠9ľ0;7}{Loi-hQ'}-|ٲt0鯯^ƺy-gOe2׹{qy'U*"k*i&I/vϸ{Z})Y A'7t6Iqs+sK:KkΈr:~ffBMa#Y!}w7V`$le o/!sk5koet7u>!otAsc]ci^ڽ5Vn/Uo﷎ 0O^(GnEWlj?oݚLf77x,s7xXa3n"{\s ۣkco>|7 c ^x4=M Wo;|O7o{}Lƃۼ]n&L^pk6i}g9nH}l K.ÏM]iK 6gϼI.3ZK]Y ~a}t2ӝM%hDR_[EkUs[k}` .[Ew`tiZfj+CG5,FV\NBK)a|6nfk-eۅӺ@<{YqRZyO 2Ko;+Ż,nsymah$tr0iA"8j֬}u iCk%Kriqi?@ X쑅sI.6{yW6/q8[Gq8~k+Y0Y٬" 4aoL\cckA&'Cy"*(y T˨}2ٿwr݆n^FAK(dhMYl6n[KXy壂&%Z 4%7gKx ,nlӺqmؿNӸخ./~j9$slGo.]A{z`kZ7. lm믩}I﷼ݟ:u~ymyem1&˲f DO{mb[6H\Oaw۬uΨ-?MvܲF[Fc.dH'W8A"KKe.5H?^_kyϼ?LC@]ZoteuVY6b#<;Jh&H#Ij}ͼm .{^.l!{-;j mp mU8~~Ii/m_dώC{?`'t8vz扑c/*9Qa5NඏLk -w[Mz&ԯZ#t6vJt%A7sMyҺe:/^Xn6Y˻\z[zO;# B.[t=G~" 9.!OZk>+xh9ͻh[M:kXHmAfno-q傶gڒ퓽y:[Kgp6nv3w\N\!oXK$F~3M#"Q9 3~ n d\TO{ZHЮ3sx07neJ|#;`Mm$Րfn dooS- Uzh{ln,VXmmIop4?pLkK̝ƟiZKԘeĬFOI ~Z.7 7MyCmdc:sӸ{K 5uBō?64I-f=Ծ3Umg1i5^_X6k9mOPj1m FtωK:M3 %ͻR],ve}BcT4Z~{䗙vݑ} fMWl)99I`ѽFetnwYԋ{zc?pO&z6?G q``e`p/qy )_:*'c}#ҹ-)w&5m|~f{Z1r2]8hl[mGvcRֱзM6,Ah:FK>mw!~R O4_D%bJv sڇs]Mp.inX+'i ˡX7-s\9(V{=)giX>cM[nD{^O ]u k$X- QwVw_m70Z~-Itw^jwd..& ?#t >]BKFף6i.翉[d%\ItNcAzp/k{[JͲ~Nq]D%rxlƙZ˨s0 KAyG&Mgo;iwWX'snR8 6b;!o5$8C$/V {lx.e"hǖynݴS|6joo/D^bdngOcK7 my{ˋ^uMҙa7qX:pccU,C5 Pc Lq2k6P&fՋ+tbu\="Yo[~=EmKx^_s>m[չ9]}U^KȵF;a&fH_pdp[ss|n<@ٯ%#{i{qJg/q -O}D6yz;nk7>?+^('ָ5@l,"ykV+sQŮh>8. ]O[ s7vnj91Zeou4hc-3rWH"48HTkynqz=Ѱh}1gS%t .Qg_񘬝R +ܶ[o.vSj;2$\S bP˝H_5W%}:%z]Dzr;i"k:?y~[at1\o˙{ǻT9qX]]Km+79i[g&H+myEaW )/$&[6I]!oh-U&:]4Qssyo0k{-mCt$ۺF1pcKp:-HU5>Zh}E:L䭳{Siܕ9YImݝ/JDK,2hd|RůcA =N v{/N[pZfq+G-q )!Ã|9ݝ;]R }G`4/R16~--p =Z #uc1y, __Oj2츉/o֋{E:$a\s;^yP/owCGût笆 ?oM[Kb,hZvVi:-Y 罏ܵ򋸮p=Gqo1v).2f-[%S5WTmN{$oз[6KMa_Z,h]%sI%[O6uG@=ܮ~>߮ڱY39]e|{i-Cc湸=>GyUål1H$q8h5: cd żk9緻+wH)b:էOVl!gqkc##㤙:F>1<6,fo'%/#cuh枚9|8lZ=yMXLpTn"3[s42'O`H,d6p%NE^5mMp F+7tbO[#̍qYlcAjs;,nK!.ܫKY]jHj;[G j 9m!-tn1i 4^n经w?X1> }V7e8{H>Yda kn1qj];c92m&bS]A3.,7[̞.l4RU&:hhq\}_d|.<լn{m̥,1/s#2.e3!}7Sŗ3bDcphE*I}H"-4I KFaoe m//n"0Z$cdtxXF[BOX2œ7Y lW)xy1rYQj1mXLqK *b(xisĭX~mެy[+NXeDz?gj]M&_\$΂6dcz} N:\MY6N5ζr h?K~\Hq̽j$Џ9N%>Dlt{oC@@sPMA,$v{Q] ]q}-Q|7yb:x3`/:~$k"ht14INs=E.'9]+ feOW<:EjcXV7Zg2q[۵j\ V[T3h,c>x8Ut楁ڇL`I9ONۍQe8iO78nCӛa'#y,YH#mckI9h wGqp 71D#t񑶖(GHf%mlHޯδ,,2M,^:mMCC[F#{7_G\Ymk=]a{u>B-isjƽYI##wi$r6q$½ k w}qC}6fgg{vHi1ef]E{ӊ y{>C Hl.~3. {[cf^G[|مCxQdۯ&ՙ& ϔ C#78"x q=ķYM72I/5EQ}k6:d-.>PsvVn-q6z'Feqk!qqSǒ;gXK˛0KK;(@in,2GQ{&iEvn8*ȭ 6 8Da c6r(•vN廯; {%BiKLqqynhKjܽCocY/M&6C W}Ĺ[Z*iEXBO)2xT+4dtd^׻Xa4MNk\LEȼw඼ICOs uG*o~_jMYtkN`t^^ߛO;okKu 鶤>Xg"q-À-4d[l]Q⸵y4,s[^wkr=wqyu1O麞\<:@7&4='<^\GmWnȰWQMuIa4`t0yrNgw;oVGo=2V1yh3>sR|9bqo@m ;{u dM-6w̃cqu̘o H4!3td֗y}!_cl8[J6IKK\Zoڎ[Oe[ust˨leVL+B]7Q^o8,|ykmyeHe,rbιPjgKsَ½voeF)ؙ8:$ϡjMƠݎ'#7mtQo&|[r(kH OӺS]]q{̾-r k]dw-S_[m_ikٞhn[PfF[ <,?Guc~+{vEcY7qdd.erbMl8 [po6[ #Yȵ,Gz:\mk#kvɒOŞ3&̭oŭݑ}u鲎26' jܾbFEO<.rYe%:8m[K@c醦1ZJNtu:<<(5oJ -ʶ,;+̱j%o5?hfR 12[cH}hRL٘49x|F"Sh D#P$^Fr>/g ż=rI! 뾘#z~ .@9ˣzaffﻒl5lP/ט}m=LTXr9VZ+;s]VҷծfZ+0hp[ue1&"3ZJiiK^MnA(󣋨<@\(ܭ PnK /d5;A9.=K #o#խ sD;9ä\\Ck[RiJ{ Sq.ϊX,19MW[Iy00hʂ \pR۫;q7<0'׼ ޡJ^i{7Vj m= SY{ ]^ lmc.$]?GSE5P(-a`˂fU#yl1y/.k+[+.k7G VYg{s.3^ڂT/57GLVҷs7$3v2l'+%ΟeNBrmEx#{CA" 6n{ewRGv"6w\||1<6 @lFtPy2Z1{v^)#[,dqɍsE46equosY& c+\"^&ǵ)Q>J!˺͚yeѼ\1Dcd^k\D]m6u2W/p2| {{!Z?V{^&n@Tc;o>VNj4RCsfu1cb=4+Ow;ψNg4ZN:K,< -[cpd<Ǻ/1f^[+&g=YO[G k96uܘcWx8zz<ֽqy/..+轼iG K(qԑJ}Y6b/8xGMyuӚn䴑\: 4EyZfw7K.bcKZ?ɌsexTj=<=5֫=|}θ3)qj5u$VWQ^&FlZo{$ +Yu]t/F3uĚ==|:+ۏӺP[_.ik]rgIdGP(*>I{G,FVVK޿jTG?v"幭Ms$w7wSEu).`êBIsqD(B,"/t۹"(K*h5' Ն[:@5#h_Z0(u}JVxhK-'%C\bc`延'c_qr}M66y8%dmWYG X{OkH[Щ= lC^ 86 8sn He63up[{],mXJB|eﵹh{[pJqc$s釩PEe> h1>C\^#(hTp'˓ۜ_O6HnB6ͧ1B3Xm6t܇jhh}a%l쳱G$l<9|ϒG9ֆtˌF8dQ֞Qjks#kK .%-3hkk#bX "ht#Sikev$4[SI6HZ@b.|$K\DؼJ0 V j ֲZ] )`_Q/"/t8g{h%hujQja`ٗR[FLkvyd ]sja kj.c )T7 ҕZ,mOOa$d63nm:fyqi2CK]Ǒp1kv]Iq/!G2[c>IY+&c7֌'nlŻ[n%t/spȁDfXC.q,~-􌹼}⹾5- t2aw.` Gcb,1ٛ{y&5M]-pqZN8-tv02і\[2.uR3JWt̍D&=6)k>ezAKYS#z@t28= sb}PCNH^pu}ҼImEk,7btHFuG开ʒMCqK{kͤ"?M1W Zj c϶"1q dlrI$N;go+fH1Jc{x5w{q=B6Nr(liD`h5SMpmY $sۇ;_2wGJ2)RY'\?{Quj)P@!s\Ix[yM ZG 5!c'WP +F(fBkwEq.@VImKE,e$TpS-J<:uOP=!Ҹ5 ꓌d o0^T-#.?#'d[ |4WiZNcˌjIZOp-ʱ7㈀-3=%@5 V <="V"c9cFmTux#uյy$\>.Bc$4kz|:i5hbhgsK%X!c嵄I) . ^ 0Ӑ^\@xV39W\:9'Ed(\ZDft_#׆!{\[厡+D KJF٣E7[dM/pA%A`WPVք8CĚӊֵg_"3͎BQ-{m U&p}{e ik# .%mO.aɊ"zZZ[$2X^C͐05xNh45 #}N-y+c#ufK:y6X2 m $G5۶PϷx!|j9A[dt9Y&)k8<\zOu1NdpM8 bxL|aI<0Y4 GSI=.Gqd{rV&HޮnȄ4yU4_Vy-\rs-DD6 zIO:yzj[PT+vIg{ty$[4qU\:y$aϣ]Y|{/GQ@ xӊ:b|6p\>:(r{>׭A :jAG X!>tsCea=F+yttFH*36ΖN-`F:\SxrZ_/d- 6?q )ޮ`  bA.OaF@ZfF$ˎ./ld ZP*c|9cl4U7GQәVBI ,ldqѾf%Iw*^i'ԟZ m5K\qqqo3˒V<4/5@*M滢AC\HÄIHi4"5UIK r8+c&0"&(Rx<AOdY8G̎gEXCI$qk!ÈGY˥.ihљ[!C+ Άi 9~2H-{LqF\O7̕B8JV@p5O> 5JY2d|%`{X!{!p%-p&N _pK{<ue2 &VAG\/:b{<9 \6O1HּJ#5Pcy5cC;@JE :HN>4} ^ޗ=ōt֍M9=nx6'\ 6燰C](k]piZ}5s<ǀ. <0]8RR|E8ψT@`85(Z Ph T8Z+NdUV0N _) &94icZH?G*},m<5>a-4t:h>UQiF׵ƀ~`<(xKC<(ABE=h.i{cJ5kAƇ GY!鍾\-myVäKfq|"kP8բ"*20:D=u#V2I-=QB`})N!9ǯ'K@u*쳎>2cAIqYd->pR5c 4u*(GF9.Y8c 7iB@#\+wF3@ohc1tg45)) '!c^*F5i )£ i 27q4]]Ao1G$`keO@ gt,浾o} {zLr1:jUWN%͎6,dĵiZq>QI43:ik$Wٯ/%KgLR:[D5:H4I!% {b-1t7qw"8R:GH@/=4UkCXƼ{= 7A_+Q*<4}!šA ? C^8:b:A4V=5qI<.e؏Ka{hz0ZH=<:^bw IFr@h&W ew^BKu*IL(vACw {Ϭ67}`#$5ҤҔ b# ?Ydc+_+9xs #` OKƖ>sC駏$3@~.H缴"FD=R%]Hmtתd=.C0,k%#Vq়Iw[G1gT=r0&t tRe9a=1劁JU|^eqcK^yӀCc";x'Y)0$kRXuxWx6^LF_1$z->&y-h~$qs'̣ixquETհ Ø10e. kMO%2):t&gkƫ$5J}[oM+ ,-lq1"lwKAu6ѺO{:;:kf{!obl!r9ት(_$lq{5ĹƁftjCzcwԚ5Ӻ{ a}fqP w1< Gvo=d-zr,.l]#5$3s3ax-丒6]pf,Z .ώKB褐^I|>]ol4jsm%6j =-S; \M)ՓC{urDZI}ni{=gv+vo{PCvF6 1ih/C͎{t2Nؾ#XnZY2;Ki uHǵk lq< {6ۦlN>mw@np)q=;16=f̎kt6sKr4%vߧGfmNfo-FiI5՛.{:)52Z'ILx֘cEd"vbGNd6Yn dq9-hjJv޿n߶l3ruPicu>REi)y|ouYeqi^.{؎F GN7mu\Cn4cqtY7k[Ƞop2C1j6g,{*奵Pj=ݗ3Cbl78.Wm@4Xc/VQCup<&H22 hAW^{uc:wl?7phg:S1e˨vg-o0Q n,olXC~ۈu$6~FחΠ*1=nj4^d],ryɝ)&oMel5yL5n`63t>cu5J3v=-4kp Fc!>kyhegOV068!uȕľ(ǴKc+zޑaZV /Oh]Y-kZ7a Hnh1+|j_kR=6f S}53Һ7b霆[;YZK8xK7#\7LPzgIGч X8V#l{L>ù;LMYk&[ٌ_'7O_irۻVZɣqDΆᏉoKKxmySۮɆ/&k!$i_kè+u+7pa"sKiFC@]>K .wt$ [2GCp շ5&VnoiӷڪIgioEj ̎u"79ĸU/xzV:c%K15%gs-u6kA!:gt sXb3Z-.ish< B={lv[Nd1leuf֛U䳚V̳pf\\]/{nZci+ncX{' ^ga`\M,ΒYd|=\e/%fccX1shk|I$]HCmx^n{ ՚#N] b8; ݮ>Ŝ%Y%sq.7f62az otk5}jU_?t:=̔=}7ַP\6E2~~/dDt8V]㷏xl}и ,^5Ը\oG{fzI-n]YN⼶ͶvA}iv56ktNRmMmКBŨ5{FjKl'X^]s4a4mbٜ3rͅF 7|R5ii4-=vk^n,F]EZuwEiXDYgY{fkBn%If[Ë;%Xwjmi.o9g߽k7g7Ѡ/Os""kkssXKǰ}Ge|.:_:(|l'|Og>byseo;w/+a=nJƘe^[1ez?o6񅳲- r+<ǑiddZE*E)ծ{^1cךA_|a619[I3i4c|Χtyob尶+X/_V&cca1F\r76]Cqa38֎G]vmc;5v_V}xsci5ݾs!ax)j辰\=c<a~#Oa2Î79c=W729xPۆdf! 9 !_*Z MVHmuV z-2 ]m=}u\}XOolWcWGget˜6A>@bՎܾii '8@> $w6B!̈#d2+6ymnbd.$#k-5.&JּZ!Pz}g3V,ut 2!pn4;';oߌ4>4dOYWqw1Ǘm3JcgsQܱ/ ɢ{wu$KXxЀՍZc&^~WߙiK.g;_O)KR].27֎t2<@ikX 5ɌEs?awGm0}_{6&5qJ`wue@m  ḺEoes~JBhIS\ަ\* 5!w[$qm4efk%n%u>VJ6G{9?YZhEge+K ]4Q < -/} &x4 d,fi̭2E -nV <utYI8ِՒ1t4u/x~Zw=;Ժ QY錃'Cc_bO⛘g9<0r"7X^g\9#-1[YA<0qϏۑ1pmVKAc$r22v4\BYμ5d+d/@RG.7I$ѱ򘤿d1ω̧W(i|ޔCub7 T97msܔwBl>%:Hkiټf/79{^*deg դwn'|(n]xP!ZOpe+V/Y8G$.븰5x:%r:#[ v+aٗ$.# oinּ6N375_e3~/ aaoCen!8kvo|Kk,IYM%r*F^]m5~VIme:V n:[ 1б>a&m,t|&9Kqܶ,[ͷziVƝЍҚM_RIn.OkrL\XÔ} mMi>n'EGOG{#nal$mv-#e/ca\[6yK}0z>ƍx Cm [?2O S#'ݱ9{h'x΅, r3Y|TY!Ų[Uťg/*fc2h$.ְ[[k|eoG ܒ9alX$+=AvDf,Kl6XE53,=pdu]D_ivc$u1τ@5r+x}E̶DYalAahye ~-n"d2vMlְ֗u߉{nJ+,,(ԭHt]js`Fku ltOfkZZZF{D mk[?>+#x7-e7e5>(۫\ LcZwu]E-  hiio }OAs!a']K,'PF3-aaq!iwoyuan̞Ft.հAsqnn1yٕhh-q$:g}kbn3'_䳘ZcDz<&&þofsQry^X+<>HN7ntrK^P7MJwz7ռx25:8wKsZ!4V6sDologmOp:kZW[)0Kz"-kFk!mz:fo]^-+Pe=,-Axmry.1Oq徴 HMQ_uwm}>q n쐾} -kGX`U}C`GQC.;\>Bbeĉ;>cL1q C 7r 9\M9,m9uI!Ey78x}xk<w[B %W%/sK#v{e{.n ,7K{xZxI虙IG͉r쏹\?r{;V,ڿBN16F,mK]4_Q7a+P{!mas͆}dھ[s_eO [$r%MhnO2\ ʴ>܎8W/5nhjL.y,E>Ja"K%p1{AȊ$ scؑš͌H%¾,2!/6\DWMYYkcG6K9+Z#A!E;g>;cod+O0/'ѭdNH༒G!miv7T]ˊMwx6sXsycmqrJc ':s"eDeBUm]嵙$i.-28e|>U=T5@j`B-%N]e)/I#)2 T):8|3 sZu>:IO= ;xX{{sMo-ryq2lc$0<#CjB2fEw-kxv|΍v6{^GSz56̔=ZX޺ѽtXAiXjxWˆGqj{fcaVAl6]t6I\ \i|L7n$`Mu/]@͗6$pkllg[ꮓəWs8 a4pE.u8٧k u."/9,1I!cF2KF#cxPC,kCA)2F˙c-5-'<#2M,MsU"Y>d6:-"Ztԟhpq V}]v04Ms^ketIF{ByhSN֘67ڠkagåV:x}d\IzIQ| Ă tkiŜ+-}Ѷ^Q]`1x6Fj(G d%FDFtZ ^ nuϗ<4D D7 qak˨:ZAX%blD_*uUV%9$e֗9ίWjƃGjj:O[D&:$<$ht'RMi^ ycs n"pe{@tU("5Rk->{]<Ͼmh-. :@pI*'ƒ(Ao I䦒+#m],`>caoԞ*Ύ,6nmM @>% `[hdF>2ph8*h8p>H- +#loliE[h$d-2ޑ7]EMiB",yoLezK˝dih _W%B6-34dN-w rצTFIG.j7t9dfBP-C#gN`Ӈ5,}<oX|qDkIk[p55ÆZ8t,tQTGLK"- 5ԣ]Je{ZI޺Fp `Vxp!¢>>e8|:7_e٠pwͭp:۴#eb/n%9QNu8STz!Q͜dPƔ<Ú֓Q^oޗO&9w>Ť][I6;>y\iUb?9oCek [ yhq Zsj(*H\iPkD<J泥V0m_V͸wJΗŭtt ,sxӟ]ۏ#̶h.3FvshѽNq< (J۩nA4IYpp@ot|=WЇBJ9isÕ+@tB"G KdllҭU:mÄ>k^#1 88k59*N>ӜR ГT&Tp=17UkA.hTA<*HZDv;Q :ʸGҜ@S CXHXOC^ xDAPj޾CÁ"iOG%7AiJ4֊QKbx$_X1'Y2Rz-5 pRF62 %-|8@@O [Κ8bk y"FZ M ##H^X) K䞞JWC˞Y _A,`cd -G(xT F۲NWG ck"UhեU iN(ZEjhs*8C^6skx7[YZd709B/N6HGV-;}=]E84TqBW0Ytш`۹/.zhzZ *HWP9[V65}^-\UE,uF"33dle8{l5_N!IK^csdck@2.~j\RV$Ǘ5FŞӈk4tQoA8G odu:dmLf0Ek˂6ݱ\K~?~T\\ 88=kPH<= 8 _${z: 髃^A5QZC̒=Sz9ϔpի%GE9U6GV'RW(C,.s@"s D)N^%e-LU25ld<6Yke10/:SRXXGxC̐\xq? ®qy- .dHs_bA⦹k/c丄ӮI:_}GUxpTo#6WHxsM@5uOPpC 'Đ*%Wp| Fa,z>KS(W/6K8WUrK?$~_SZTW \xzjYڽfO+_OMkϧyEөZ׺9J{W*"""""""""""""""""""""""""""""""""""""". ض뽶[eĘ=#y܋ J<kaϫM#dד9q<9&5xhjșGbd}kxT#ݒveo&KWruŜ8?cŋ/ss3}xom~4l^q/&?So_[Ke{yvB:i],VJ.RdqK0V9<utAi-O7Ap}=iٜ n6G tݯ2^d2e7[s ЗK3;ťdu|5n-9]iuVlƣyגm6Akk"8a19ss=\駙HR~`88p_;wuƤ܍ԙ-]vJ\?Ku{u(k16Cmm #DFƴ-!ס5=qw#DeZmӺHfiavTiL{[[]!ɹkyz:dcKMXfh!wDK>wD<=psOK !l/Xj=:O_j :Keke|qZL-sX<^c N)|eN%ޝZ]i =+nҶ.LI:}[d=栚7$>kD#7>w5wmp&1p^ ֜sWznZ7;'& ekID#'z{PK;|E W{(t㴆ֺcv6?4կ]1ie>X đM,@C.fV[~)&c[qGG# P*A#w lӻlqx M;ku.k *Q1g)dyd>zo{紝vo/K`ؽ[y{Ps)yܘ粒!:&Kz엓+\j[L6XǶSi{ K8POUHk\g5^f{ˍX|7SmNhg%K2kI eBKkm4N;f{szF{ ً_ydpBڶі͏&.F(/.!=Gii+[ -Eh9F=KvE$;oReF_8.җ; IM̝Nu~w\ v\%&@t1ZsM|[gt;Qh=qw@i.ٝ_2z?LK/eOi܄\,:5.~48tWO1) "qM<Lt@ %H}þ "GƗ|mKC)U2z\X$H[Tz$"n{rE]9%=249H`Bdǽ Qk9Oqo;jnJ=Z\ޢ;'\9Yq#I;Q6Yr>?x88v/Cvc]kf‹'1> j.~_xvhx O_e@ˏC#r|H]YhMbV.?;¼<%Wov}LJrЄɝ?hH7G\gx՟LV)L; &-q.J,#{`1fUsZ[𸶞Z~"+k7;nnu憗1yzHj 3'ގ3X'ymE+HEjwy{]2i{:jŬ nѯk䴰;8oK2zfF+1c[yC!E0{Y_hWqv7;ueoaã%GEl5ϵz 7Qϰe/iٽš-DkmW.gt^3>[kh5~j%_Hdc/m/e>11s@%Z4wĽk?Qx{zSItӚ{%}'Io^vswEܾl Yv`!oe3el^u-n$>ptv#:IBǫ\L9*]!mA4%xMpIp%/pq2l͔apH:fx9ٯO5={vǵl3Z-pיVl^'sG(q}Ņ 5NٚVN gU{ 1y/kmetL.mYGtԴHa$R֋Kǖ;1nv:tn[Qxn3 r%4VLWW&YY3// ;]g{Cnuf]yc)-0BJiMUo!csL!kbh\3j=o-Ӌ{9Ȁk qHK.pky]~]OeO:Z|+ %ҶgL[|wz.h./m⿬9-/\{MHxfo9PX-θjk+ nBh/^r }:r~edffd'0 &?Gsv$pu~3)ǻzY,,,eR"1E+N+ϭ7h;w`n۾WzC9иc1:F_uՙ3Jm=y+/.|}Z;ˢ󄈈ܹsNcݎm-'Bpq{QRL&wpSc4FLZLvWq}m3^|_;ގ/ 5 mб{-zqp'lNW AY?Ρ\^QO-Wmhbr iq+6?W?Pm|v{asXbcYKIV鏨,|Oun `'q>-|&{=c2>{}Ż3lݬ!vwmonk ulx)m,,/š/>\~Ahpwx\xqE98'խ/ V_Y7 S;$Ry>X6AksnuvӚ-bl.-9WSDEinvq#I+{FtٻQ^^fGŏKYIdqЬkLHx C5rK@!GBZE@X-Gn;[6s}$MKAmuss$_5+P"Gx56LO7ih-,lb3.}n%hu:H %x݇gŸmiAo7OYl!]Em ԓr>q.IFw{57Ci t/n'3om/nIﱎŘk|픺6S' }6Lf? k ^G $m'b5`˜ uL&h95dtdr[ VXu;QDk:˜Cz6\m~]-cJg9fmL2Oo3ϗwe84I{\Xˤۦ5^ֿ mjʷkmr1xML4m_+Itȋ]y-|,&vGO`]B(n4Xdϑjg;hʺM<)ƦÁ[ƮiLg,mcYeDo.,dg兕ק`:ˎX*{fgOqtنF 3kM͓I{q'#)GzRloY V; ><4lV^lv&ؗ)LRכkԕ#I8<ߪuQV:HBc$.B7!~YHZɓ,a?ظ!tfx\8a&>DSq&kCA{4Eܚ nYKwɁͲEk۩[^@RY$\y˙fҗW6Y[0u*2M 'Itl3:W>HL˶At 'tjj2Mj$k\FkEM}|fwnob֖\[eΞZqxKw{2mZKN{[,S!&W3cZ#HzʊCN]mO!? 6R4,rΘ56gϳRp9II"2(e30 @o}/qFZJ4Τ7WFGw`zn㮢|E6;ob^nuGK\}']0c#K]XɋF@w;˧cM*cwD"9F4<O_t K K=3˻e{`c]/ @{]) ,~6ػbG\?͑O Neêϫ]ukQ\\?Μ1Z}`I,n\:@C*M i„r!R+J\`#=spe3m] KhrZAqkZKa7]m, *hחXl2۩,[ DƵ[v؉s|TK@Ah)ç=u>"o:2lv5:~;[X2:r ke2b~Rkݓjq.$ōcI濔g)={ Lm\>0a1#hwx\dYrYl/-繷ZVn$:Y#m"eC[ǚxM\( '4? 2?>K<jKbYo""ّ>Gy0UFWZeⲹ,`BK{˹XPىKiRȡU?$d9|XF]Y^ޟmM>BAs]3,Y#.b9fϙ#Ot]Cjy`dnYHrۋs}c2{LVRT=:Ș5wzwmrqXe͸$m؉m:])qhʴP.ؽ?+Rnv؝,=swo!6ShY@׺3RuV%iց]||1/NHed;=!d6V-?AX} $Ms:v&M՛,a%e^h@-rao,:'Wgc.s3ٶ[J..W6}jgka{^Arm5mܥ9%k˻hs;Y)r>ˉpw¾Hwۛ7.{%:Z(,a292rrVr:3[!pys#QIcݬ m1m0a>S\Ψꞓ{iSwmZ^u}t%66.>uݵff=_Eťo WqmU+kk6-`: c[[dFJIc$ ߝ36[Lo"6lEivKIJl@zZzG-OO}qx{ Gb/䥮:U+sa7Jy s2ܱ񸴖BE^5[ٿHo%鯷&hWd48ѳw] /diW#D >c}覾ɲmOY\O'3ڛ[>k)2$D(NYtp~?ae4yI/ZeӤ-$u a%!tXu]-BK'P|6[vʞ֞> ʍ;[ (m[/f9b1ƲЙ[Q"b22QHr\^c -5J&B\m쯾kWy wP]K/HgӣN_l KwcKX+wP;ˑίiZ\DM>l7}kkZ[\]ya)t֦Y+Ͷs񗙬NG fI>]1^Gh#tr9Utopm]Eښ&CclZ3P:Cz_8\#5 3" a2kZ=]'KqA)l2Hs!> +.&^xݪC&3r"әS$lv/=4]r<wWsc0x3!Zs[edZcqlY죤c dWԵP&&>{HcmWue}X3@C3*-ikJ5ں.Wyf]:g[`.h|:C.糊?678;?g!_W'`q<>C#ba7c~k̺M}).h= 0Pغ&ۏqngb۾͂-}9 8F˃sKSXu},Oi'W=<8Sֳ.eKm ai3 yAsn%8" x%L"d|Ɔ1E$ɒXM+P)JzKa3X1wkYnak&0[w=3? U/lo sK҉G<@9^K9(=^#Ұ{ginY|k}]Y[K$F`%2͝N`qȕ8㻸.t {#{fձWB\/"# 8m+Ay\9+K^8XbEo0!kZK< 7:PhHu7SmR 7JP69?2?hpqZCނ\ ='9],[nr]/1'$yxyk$lּDƽqT$gM'7HىW@ʊd "Η45s]Z .~ڛKϴ|,8 BkFc/scd@ShW78=?m`w$:GE1y߂A fcc M#EĚ[dQ\nvlc1o e o:O[K!sk4Eƙ, 1VY=աҹ=IPZJ[i#0/͚n9G\[~qaf- 0Fcw]࢒`tmqsF#t~lK y>S"hOKH 5c ML`=pj95.}+Z8<&]tx'Y"{nuvƜpӍ[a tfV8]I_RB2#X-Y?S4GhP5P4!{g%] ťܽ7PK+ٵɷ|+Crc$ V;V#:dKX{_m(${D̓lѱϤ앀N>ְYYA˘f9s[DK?/Y&`[2669gg sdOT^Sb.u|h]$sH'zִ%'֨\ⶼ/u[&ݸ7\1.^cCc$B(nzKy?Y!aȉoIS͓"$Iu u _FFc-s[P*:8JZ=4vYO&\1͍2䟬5 GyZJjqv7x[<.dn'j[!?]*jxҾ>MhÉ<h0YFFtdi-$Pxp+Qk2f6Kkak+ToV(bkcq=.S. 5l*CBI V'X% [E1QTXq;!kS'>W2F=l`9m5'ۥ V:N6g殳t.l CA02h]3Fm#&rോ-[XYkYFhO"PPl..goBx'̾d h6 DA=l'MKx`I'l]7|i&FZ$KCOOMh-n쥸PCo}o3[yіH xs$Gnݵ^ed,k:ms[jQ> K\..ck YXt/]BRNSAQEGuƍjǀEstֱ˞Ս'O(#l xu9+ńkZK ȑY8Fa¤SKd7/icd!1H)#ߞUe V):L5nsCPZA-6O]124eX"s kaE$#^[12I l2Ix:cwm,B^zdkc+Fޓ4@+TM*| ӝx=%uo$aknѰ&9T9$J5GHzeoDOCz(Ҝ .>cp]3'in:iZMQ^'K4<+U=c5#9f )=M\*=J;k.].|s> $ pCHo oyds'a`poX(Z:z(JHSĊPxN&)0;,^cA+2,q5ƍ"\"{-šѷٚ<?R]h!uۘBiebl6RO@JPO2OH4TTTcmݘˣkbEX#O.7Q3*9p HPtlmq$x.w0kE`e%ENi <P+P SJ>5<@P)14H<\J΢8tV 3ZCM󥊄t~c2HN lJ5̞'џrG8gS¾5Ixa:4oƜԓsːME1 _ {C>d|{ZծK(}Â!X:#- Ln-Vt5Wg2]8{n&# 0à;BBqX YV<3`l@kO[}*E8(F_4=X4] u $ +CQB-%H,lm9" hVHVsA)A(6aڍ@uMJԶI1w[UŒ}8C)Ëw=UhyY)M2^F"2"׺'Ų{]5Z*,wQQ{dLZZqx(-^:<=%7:2K~"WE8iEP=J7 dHZ]p,3{t^H\u>Lr>B-_0$ƊS p11̓G年C*f!$n7Is<{`{'cf|S{AxЅ>g.IyL6ChKԂ8%mճ#m-ci/N?>zEOQ[:-ր]# Vh8Jkdd k! $,yGEP8P0a\Vbc&cjkT-]-Gdd!.`udS3C1F=!.gc+IJ9ŦG֯y1mh-JUėԸp<hW9{C%i}}u~ xQVv:h!X l`4t6GJ~׿hxqTm.&sc=  5C)]Ccq0m/[{FJ[:y-g˼={,w [:XH{ X%h< )O3]u1.MlrGF9O]\I1O98 wm:GY@$e:d&NZZƶFD7PwW\ROʼ|R΃IJw8,Xb 5H<ɸdt Dc {,5|x#\G$krE$&'M;Keu Ubd6 {&6k6gdJl8F9d10iB<8elVs0pls59 8^ -n$u c-cZ4sxUzI[kҺH`ڐ6ᑸ43 4, {3ס9#w "kEw/d=c#|j@#a/yH* {dwA$ E|r\\I ldRHG kAwP>!c.@w98-paRH<V"O$ˎs Y4tyHh+ >|8zf{Xr"$#|;.ꈼi-oG.cSZs>akCdzI`o/ |X<ѸQkٝY"#ejbh`kGMH~։f|1Z44i&b_湞@ 5!B ``kҼCYXJZdwΗ:7 9#/q_iխkNqP6u5 חZ3# 7ZA ]U-uC|1-.@\9Teytt eyg\x(p-piP=\p$}5}&JQGu\iy_D 5wEZ+c Zk|lN McSjء=uw0dyqftq>#u :4q|$W/l>q6wkvȶ"a4ϕ98,su(c峦6I+;]ص2+MG|1V2,vz.7Yl"|N1| 8具\cn$Ae#JaHk'ۿ(,m\w; U[sbslr]͌Ӹ1rAG t2ےrcXoFj)&֙)/ef?fY &b 6ծpK\pB[ L=-c'6x񽽻ոvM5>wci,rK0`pqB shZ=kZ\ֵ95TIEs\ֵ9IE?8lciGi #kuf_9tQܻYn4+Vy' lxR m0lK|ҖYɔ- /e|b_:వk`+Ʈ4I݉{vCl铥3xLƛZY2ڳ_M曪r0[a(l{+-KqzOUoFYlԷq}:ie5<;m{-y`Zy|" ӤF7ICt %dmYG:Aop\ة^%|knԻV7\K,KQCz^_;)Krdw|q.(Vˌz}6wt\aHKl^1esrX'vwYq̕[] <+;ll9A5؞9ŭq]kflxS;}>'Ciisז2._ifk{]Z"{ \oE^Ntyc'mG&]іZCCgXj bQۋq}R,߻`O@wB:XV=bF_שvgsnK{;}?23~?`,lnhueEYĴP' ܶisS=UsЛvmX̬ s9i`- X;jgWCkg$ܚâR6 K.`]Z3Mv6-m:=3qn,vJUYkkc{ da o&lm/Z'1mh]5xMdٱzPGŋsDeV|uݍ=&cydlQ86uN5n{=r+WM뛭 Z`GҷpdX5Lt{]%|Ԣ""m~mGjv?Rǣ.lzA:JRԦX\#0z( ~k9<7OK_%e\ p<:?)7-{O.C%wZZ :Aq o|߭OimΪꁙCc?nV?yl ?핻nA8|^`*EnN,$> vxqnÇ7q+B<ȸ\8ⱻi}P5-$>Z:I.s_q԰8hX,%[|-/qB.\ޓu]WuȷALWne?ľ .=i %}tM/q+ޓsM]}j+s{tף0JpC^f%Y4WX\~rx=bdUvR{ٹP0KdkKݥj3qvx4Hʻmdg,3FZG(}4ZjE#nũڱfSdk{8{bs|ť|}BrO|-s'Թ k?rxMTټm76lZmƤl߫ꘜ"Gjbs4(yɿ[Y[[;wTQpC(!wz ;z..hwMs51C+cN9ms3d!e: 񻥡巑[s`ɧO&NChq/ i)k B9dem_6' yBFB^xVL]p6'Ѹ6R OͶ]6} jGF[q?)?#cu%x^"p 31psi\ \*8[OqS#a2|"d'eՎG+$SDIdMNyS [mxZb\qs_Z#Ȑ_,zaͿLfx4\ۖ^}~J۳~h=.oH1YGvc8vD汎8=ΰ I&3v^Oz6f{pOe`ȴ뇾7ҙ܃#޽72{@nQMv󻋤o\DzGI5]w`+ޞwx^g6ɑ鹳Sf [˧=V]5O׽5jg#-mmCzG-03Xǐ9MIy6C Kcs#s9a(?."tL-l1.i "{n6Z]+݆պGnild-r1o|3[95F8-s湮-sHs\Cj(Ap(9i-sHs\Cj# 73αGuvt-4G3z8{㷑b-sr ֶs8wP/KYzdd_l^AC1~}`W1w#h]]XƵm%LfRy4$x!}Pܡ/X(okI{C)ضYGɡ2Oo:ls +9'6$2CTiaD;rqq{H'}` =Lf[Y/{܌Ԛ/ =Fqnw$FW̼c$ӼKU^T"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""TDpxƣQ>Q|P ψj8C~r)'4 :O )>/,pf.|]1 `mW fFJI ]Nq{:-YKIMXqWqV]X:hӈ{~qŮdR`,.. fi- nr%ͷs[PW^oXM}e5>-YNlvxaHqC#hN)en4ku퉳VP\yO6hgcm =gKBA+]m/QetS-q~>8/:',}FeY -mZI]/C':G;kӹrf RpR`a<_emquq%ՌR2Z7H- KFIs2,O$3L@Xme u4?8蘆"Жe8ch[s6&H w7ճ=iN .m0socIeeoqw6'q鏪<E[IJ ?JR\s y!L7:khh& gw]]]E-Np ^mLo9ew mzlLgn/af@7wm&>wj'ΦB%u]`1Ik/,Y$lQ\ILOUKō9 Phv=[]wLIe,V8˰m-t~: 0-6Z.dѶ6V-z'1X6g-$b죺-zFѝq6iro [1;Y)3^(hCֆGI/I8p .G9D94[ٙGԎtKtCuC.OM9aK9 \FiBHYFlvRD}w6w6QL7P(7È-p4><9r[VJ-yzwM]]b</[ݺ@..qɧ8{y ao@I$;l>JP^anfq02*#'FO Bԯ!d-1oл7џ[\A =mT 8 VА@IΜWeҙf_,|뉦.xFK"a.mN$0'3cnval#EI5PW<Gmg3p.]RimͶG:Hllwq,=o4P hj)˟@5H?1^PCc;-!O%vrC} F:3O%Š.E{w#w$z!ܘI,%H߭7/a<6q |r;u56K-.ZU?,MS6`zhIfbmY=:f,۪@1Ik|f5C7f=79[9{Fe3Glz#$^zZ+ִۍ@-ͱHwq>W3R c.Yms:-d΀Hn&˜FmtSȚ1SBExYACtXz9kFn ϙ$9?L|-gъ'ۑZuE}:G?og7mn|Y Թd4 -KoT$.#:_ift,sR77+Z.ly L<@N"8h裖&^Oٴ{$4<]6C#{3F&x;9yeŶQΏcoowfc97)#[hptF,Mhc(9o')і);Y۶yBڗCS@R}#SOgsq-\en8ÍA>Fch5[{,nY[l~o (v#g<}\wg/h/1hD̕ qcgIqNs,w tܬ%su.~fX&dѽKqIh(oT2+ivƻq9(.p[\[,sytl, (kDF \7\p6QkM^k.$@6|[߇&q--m;?|izR\e+1[mť'NM]>: wO1osqwaɥօ{WKh9]mkkF5{7e:7?ԭm餷4>tg;`{eƽϖvbK̎)Ya$ka Xco@&0@%fw_O_oer qeyť^^Y hZ=tZ]ݬ=_múP]odsחc1v` Ȭུy,Ai'-cZ~Lilkl^DÐIUrdbJ.kX(VWY>˨c^g"B!dw'Xjddl֎ľgqi1w3>(֤&GecZ82~lK.Y|xrs[[c[/SayisAF UӒdY+-d$\{ˏ kio\7'qroW99d\3̻//'=O(^ǂd7z) ړ7IHnܕBtYCL^7Hi};6TedoffˌFUYcqo]'\9196 ,4ޔ2q, }վ#HF\fZI4=$-Ӗ|u݅խ*Kxusȋ+8ϒg9 s[mLI#u*[lnͶa"Q\;bǵlNYek]z:hOf+cmLqsu_{,θswIЙͶO"=G'qaqmqu$Ωf[:\h,Tc-eS_kgMaqo'ci%4=#A H[_t7!'okk&-[s ;㿽1@،["`b[ӹl^+%(dy[k<ݵ:;+ˡo zk D4ԹrĸLO)vR`r8<~'77cggu,gL@,j5XkVwdbMŭĮt҂*fwO#43)I,xOd$-aagq'#nҭ}4qw33{3P1qZ2X~eck]>7y6 )mklk|;P\֡_6:ȵ/l6FfGya 8}nܲ}_/2^{,iHH'._!w>᷇]egm7>횷=e4vsg369m'}~ l[!5ŽӢllsaS˪5宠U2[Amo>]fbʞ#i Rwy :~^4{|}z+kFtEe$|05Kҽ^n®w2m/yq+Gǿ3_ "ffx<л cxMN2(1[%ZO x7q\x6)qk\g3y]15d!_>^\=aƠrz۷ݺBW/›b=sCeI3kkr\&){Z~ ū8B;|{Y1\Il]=Ox{1ڹ]d45 y;CuL]z` ha`lqdbl$YswQԚ6\Gsc X/#3[ 9c@u}z3G3:ceY[#|:V*yЎCf'xh]ks8 hzkNA .&[R>heB8l1[G=Û-Ȏ +W<™݌9@G CG4Wf?-.:uԭk] b mGFVNtb)%ž y6vYC]oh\ s$Tw/Hʂ7GT>ҸQway8.umgŽ mXFhV\c9Cs=Z3)?ھK+I~>xkZk!FҸ Qott['XCsms(Ûw͙9Ơu! #}zLNFI_3jI4Muy3nK3Cj=L OuΦ68i`KKL_^ovW6CnV5Ubu1EKHڌݹk~=ap>hMiڮdeV;XI^a&Yr9̉Bˈ6Qr_Z~w!sUeq 1 esbq@#͐ICjڛSޏkLΚ+mA ^FVMq ^GIm.t&6>偌|}2E廢KoWdxqh'{..Hs87c|LN\ 9bCm%sߡ!~|4N5rǑ<~L6O ϸ:A8s =,:-BO,X5V֢+ ?W'L ??*ÀfcO%&g0zv7Q^YdVsMpBܳs[Q8DX0ci-LL9l5q1=5PυHN!ha-|6o&~?콎gkXqsCL^mʍk OgkÃvXi,x6y(>to(|vKorF;F2\^ٵ_wxNVY@hB)Cd&t#_K5P#9 Ybu[2M~51ui {x蠞ֱ=ؔ5hǁ˺QAglc!dn#ua8>*Hs~KIi-X+^ZFO]C045ǘuӱW:=Nq䙍Γ=<U \F\\d[؁K|#+R-5(8i_]`1׶Ƣj( $4ԊZ&Zi \ͫb{o8-VAc?6g4Z,3axO@RhL>o ú-򽖻٣* z@aqK[[[f5g lI-5oa,N$;wEd3#Xes]~@_1춐FD 8F~׭NjLMkqLk2]5ȼ6[,ۀ\yEM{| zY:_4[#$]C[\F˄QuK,mo6=㬛bIs\C\H%w ӘcNRR2w9{xqػgogs!Is$wp{A>Ek;Y+6w3GD6F.dC貱뾧[DƵw#͐722Vqh<⺩nkLJ7r\NdW27}s#dGyarpt|jc9OnL.$:8/9CLe|xD oI+ksYG',}[\8ad\Ypfٓ̾A":}5wc_h/at֒(B[d4ZGWmV2Heoӷ!cgsxc8! GIelKo 8~K]wtqT6Y֛v͘Xud|mS^a,&:k8koᵲ/9@$,xii-li)=[o5B(^fM8Ncf4a Z얎uݰ30Α a1۰Dۏ-l2amj)UIm>7s/7Wi.$0k ZXK%ė%mCX [w8[$$s{H4\s{2p+zt,0yK <x ҋqu=$GRk;c,Tk^y214QRz8Aw<0Z=UlttW.uI'qoOhj)A^'Cִ'G(w Оz Z<ֳ9&H╒y01yqK 9iWQ7Й%cd%s9ğdS B?CʔCD̕+I  PԴK NbXO olLђ/_h72E[$leQ+[;3G!<)_+~hO Tq&sjG6@K=|F RZxF]VJC'G.$;d෧Kh*D..Y3fp6'i6= GSRP҆<&4g̠Z}zXSÏ%a ʷ2憸0XLo02ZPEmuŻ]nɋ1CRKd I o*T#a" mk7a1s\.kAk'"*[F:kb H"k#,#*YgeclD74ANJN|EkB 5!]ceka@!G` e \<;LC+^\uIx2%0#v|8A+d B~*kJڭ KECkӊVWG i[+D]vQ gImzp/1lƾ3nyQo!/QR* tnlBXa̕% %|/EŁƤ8PII.=$\V-k3- ^ޏ*';ڷy αSU1lqS)c<8xtMe>" h#]֌!Z(+̥k G]B I&9U`tMZ7чZOM 54RH.G[\s-Ω' +^H;5yrH`={gMIh8Pp6 }}*b(8g",u>OGZ?kyk^WUldUkm8*ƁAQ__BK$RBKLB0jˤTj*H\sg1RV";$wtsuΡ85mZĴ)I=A4քuQp,+3̈j$"𥳐5Exn;`!iw@!Ή#d1漂K\Y#\֊W'Ԡ8t<TR(>l'm6şGk㑍,"qM+<^i(ԧ Q B3寊HNZ{E}xGI-ƣ@PfO,6b7pn|Ni:z9x+[֭;hx_%xwK:\1M966Co̓7DђF PBtҦ4 PH2h{n-׵u\IZ*9 Vny$4Χ91Z\ڃǒK1ZXu=Ӳ`%$8TeRJkQ@dcbkLRd0֑ϕy+0ۉpi+ T1jU ^:K!EeD- =&uzy(T pcm[:p\jeXZ%.]x,G5{ZGnǹ .IMăSrYrW֖_US[Eg4M.=7=nx#pyTqї77665@c e`.mZ)\9pcm#:N|Z RcwsKsXC1s:AnsH1:i@뎧kIKXB[gҷ)[4ƌs\^G%]쫥2 \罆'^*A}zCE}j{f.%¥ѱ 8űW=EXCZjz &54VsX<{D֜C9Ҝ y+hmmE ϒbzZݎmp12Szĭ Z 'zE@MxxJ㷌:I>W Gm*Htu81Әa&_qG>0@4{dwQes uގ?T>,q=6EȮ_%Lgȸ\.ӈoLAEe]?DDEZi1=Hc l.6; dY+}H2g` }R^Yܙ4vqd2&: }\S{;cw|FXWkњu#tu7Z桂>F>f9e/o{ke;Mpwp.7re۝at\>caҷڳ'^k]mՇ5l2JXgmWigʭ"Xk]FZЎ~Guݷm{_O;Ѯ2\~ImuVZKs1Y\uSM^j|{O&YtyrƋZfl^zd;Jw;{ڶ{pÄ~cZV|[ q7eɲ,-7sرXN86(n <: c~t9M]݁h^ڴƟѹ,;8#ֺQd+![{&R͗&}"Ƿb.jte6;q[Ǥ6Efqm/f3;Gjx/7:Vf5V؛6l.8qRigYdsY|{{YE ,qW:E3éudv?l uWm[ӛK&vW-4 }q5>W=Ao0wE@FB_*WB""/N}X n۷~Y tޞa{y팒O& ~R6.\Oc2,sdSZOx=}w#[쇻E3}Ԛt1Ւ3b֛Ǚumո/_зXmǿʆ#zƴ"ֺR&zY3ڿ\jLޮ9,]e\9;#_do$kuq<<3G#7#NsWɞ՚^jM5nN|֪:15&b\3W-FFo/ Zʦ^[Fۺ5fƞ68.֛~Nm^o)b͈ ธb4~S',D >c|b^5qcHJost=̷]]nݻR欦̛Idc'H/ R:I}hվm)܍k_mrOY:qE{g5c\EZH\K^w0kNDۋBe͒G8su ap%{ݢ;,j?_GFjx|7|,u&Z:oYbrqD@y)K=~7G{#f~lQ. ɱNߍElyL<-uDʳhe?苺:[g{OԺO클)xN׶U]3̎={/ ևFgr5͒%%8Cﯹ'- MiWytݸ s8Uzg򸵮{洍*QrB{Kb/hظ7;p/[髱~W rl|*d8zS^His ns9.ssKj\jI$+B9.q.ssKjI'$("""""""""""""""ݖ.n |^YKM;<<;-m7bV4}iX\[lrFOEܦl-к o.&iKJՔo]?¥6Ҵ^ct[^Jo^ 8n6pcοZ<kock}qdmg#,T  g½ZE8L\) tƹnlmm^fH趂`/eKWZh-AX4vY ߜ4җ3F+q>3,{1  0le lRpخXy psΑҽfo?ޑD5ݴVx)cn4K06H0Y\-%H[efe붏qgaPVZmeo dֳ85k]9X=x[h]iڛ'7Jj0y]91L̈́3,h|o葄9KOTzwc`7qcp5FlKl뉭觗iuk x.lo"僦Xڅqkwse3n-'f|N-$TOa"fnn ~]sW7ymئy|Eo,ᣦX׻;33{q9vO\4ņg16e$PBjodg2(+̾H^2:2<~~N_.g #-1yi4 lx[L2䤴;к'f cw#:!"&L`j.,R"""""""""""",EjL9:_1A+bne1װ9Z^@#{H-sAS$b{7HC湤q,ΜY!j/`5&g09U̶Y#!i^^F(2W } r~;Ei=ͧv6p,0֚kwm"Ƚvݍ+1]۹@://;N^wYlVD뛌MS ֘w2RL;ҴA'Es eY.-\I|2{-١u|Y_B8e݇lm՛17mԑZm֚? ]8!7Gq dwlƮ""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""ͬ\ɭ`o|wd,yl819l[{܆wRgm0cc c^A#eye-9Zz×/NMB(gf;̻nn/4/v>6*;fEZ 2&k so-sc/u kk3ǼVmF'T?o5cz׫1N{_VP=MƁ&_Me.3jZշ9-a ,fnF+_mg5igKZtrxMG6/m-.Kasu)2W]+ml[u=R9iۋK_X{ 4sn8n=oc(xLۉy|-rd"7G`+IqƚP(ǗpOZ:4:Hξ \͙97C3#/.ְ m_d-Avc66\v=n\E:`xp:Y]ΧT-k&NdqFc'waw 3PN\=c{ֱOk;2RK;٦jg^Å=̿U=iVyt{kۜllmc-}G44uӁY;KW`\iu-y`rvv^^@.lO3ᕌg#"yR;ʕѼ6_-[em7kO̽Ե&Vg[cg#G}i?!,0c44Ui[-tGO;{L<0t\@!kq4[:XY~,׍x3zZ^bys8B9qڥwӈ2Vc |K~7]ٳ9s=ys1ҺsC]VI?F ,LnusYfp<tuHj( xfoT}jGZ9C%ģ|d7w冁ʃSn$SրTѺb19k$R 7$6kF֖1a{Mz$VQF1mdnAw3C텤#-boKYR0I59'ArJEl衎+" P9 L^yk$,hQs %wU=<^PqO.cXbb.-sejw4̏Rf|uGE3'xYYFGt9uE[Fg-- 8ۇݾ8,WQMrǖ[ !ԡW?_p:I[tj>hÌS8u\O*"fpu#";0۫l]bmLHCZUWn%ԺGI[me^]9={Z: sTn%zkDjk9Yf\adGu*yݛY c8y/}[ }7Mڿtl2N턺\.q-l0yJc̸C|FЮJmpc0:vv|REՙv9a쯭1}g뗍C[Ii[Mj؍@/#ӳf5&\1̙ 1g&6,G {j ٬tŝگN`ay{O 9q[M=e#[L-eާV]i%;6جf/mf'6 -)g{%א1^*+{s49#o]>[?{_!h)HZ~oB Vߏ3>crV/Rh 3ssn<ܿs7#)na#"WeoLnۍ7:+.K%Q^Cu$#lsYc.gl'M)-]q6ikm(2jk ݛ+i{֮xY|/ݲiKH.;6,Ӻo3ueXtLr%M M}VaWvкٶJVo]ߺ/jgE╤'r}jvᎾ΍ !Ec#sx+:L^g7iy.o/lR:(x$d&9eq+X; af.?Ҹ̻ǏԚv:f+ZIy {@o&Ⱦ,|lss+m+e]6 ίa dK䅲ݱۚZeHcsָX[[Ey<.tLia&ko]P#l$Ǖ?%dZ),4>5nk<]QڳΑrڝM9;rxl<4kݑ~;#HbxgXƿ6Y ;/:'pX^]c-۠HR zJN^t 5B;K/ y $<6\=Op-ckBUd%L~ܜ=R]]j{\=>_zq8ֱ-DG$8FLVfi.,V[bDr,*L$q滆ki[_X[M3Xmfn2 Qk7 LYqھ! >/-'C#g4QXDCnc gFGD#ki.} EQ#,P}NMF0UCJЮ=(m/o{c%/.cy`&Ju+pt6b#n utӖ؋G=bhoS[43GJp ^y|Rg\ gl(7͂fCEunjmn9d?C06ܛpNEpq `ir9a]27>HhsIgjhW\\#w@q4w0=fWlڪrV>KwiYotIIXK( 8iMo.^i<2`ȥKG3)3ӜIw1^kqp7OtfNT-iL|T9& t"5R'>- Rp>5vл?-Xa ̅d۫o}yspxgo)kc eE籚 ZGg0\h[\1E3. ӊtiC)Zx<ۆ0Ic5MsIG?WU2c jΐ8 5<8[Mue,}Ź9uMGE6H>%M ҿ4Ћ ,緵~ۜ !]yFOKDX(A|W)r$0SǕ|D`368swE6cufnS=XRծx{{ v6;tw[Lu Xp=Kz:;p t~{|2ҍ_YYAjʆ'=4.ͦSH\䮰<e;*xCmK dis=д4S?Ԧ mӀ9ZEa{KhANhͼGSi+ qPO+/%>.'jǗZ0S\am/MSޖ][M,TXn$pd V\OQݶS#o|M[@;-}L @JsVXٞ|͎11Rm|VB:Qhƫu5K[woPeg%\yiq{l,v29qǙeEqܸIu0\N(sL2RJcn͐e%nkak ̕k5h*76C c,5tEP9,yE"(W~_. {dmI%'֣i$rXLOɧG4vi^) kEZ\I%+k,2>Vyy04I1ld T.+sk ?͞[\IXGsgZ0d9 dcZK-fs9EakV>VOzNcy H׺ftF`-sEPHS+qok<^HHOg-HzdZ>o;aki=r^]OJOhh:,t6!P.uz=З59$GV⼅2OMsN~`$5x./Y#K| szh5&/J䥩k]uI5P_J[xk4,s^ciiMr˦}vIIdcYd1G00 .4iEe&f#GM'3zYVuyt oЭ qZ$7h-tsI5"sc"D@ ƧX41#I|̭ "hpe`L7\Q69D kAT0o^$lڲ+Fȥ{I $̞ QJ|< @#ֵG@]w'T0) p hcȎR z\/;-F9d8G4Pe«\˫ef;Y: apdx$u@q4Vh8;>|#m̲7dq_#{|]Ü%QkjY Β+_[Eso[w i'=t K-n[HZu ;" S"1A:ZF-{I5Z4s kdm!#VfVcs<ι&w9,& h@.<@qPψRjI=$xLW^1a*8EXưTIy a <2V?hGe-EM(UK[KP%|ǧʔ:{:8y>MP $QDI':Ҡ<_MHUl-z-$%ҹY! dAlC*Sܛ0h%k#1 ?Y ?JBcb{:^-Zex85-zE>Soarܽ90Ș.˅}ZjGδ$k+[69E̽^[ `{dqq5OjڼR<}A#@Z h}\3K PuF_@J\ޣNJ]'kNU)!-,EwFtytVyxl7D8cGH@yw9 lWs|$@ h)AA˘ʦ*x&e)m=V9> c=  !KHS>73Da.>ho_CIwҧdE#YCXseK/为Ҫw #cXC*jC+¼e=2I-Y헇1Ƿ 5.൱.GF%Hb0pzx#ŖtL%/`/! 25K@HƜxV ym kۭIgT>Sm(byB% ¾u$K~ا{hi-m#q8 N C@5lmk9ē ayUEr#kDV3㭯sWN9zhO=p38ZG 3UT^e0Ϲ2[4!s54襽a1>Q$,!)/X.GWTxѫ xYR7G y=4sɡ,pV 4Jr"2||rZI{\`:Ekl]D:aP j $FDUOƀMO4X^ E@c! CǂZ6F﬽7ԶV# my8pUvT52{^֔=<8@SIT69E#-$T{"{CA9.ɚ@iS"/|mkihjtSpV5$t54$J!{t<IϦ$RD~#q oy=luZGW!Χu8ָ5k\kSP*}{輹ƷAI&6A@__l{"A' wg1yf#drD=5$iR1J>Wq@|u+΢X#!1UGAV /t  CGAqhR;/,1tD[(t.LdP)/.QHD.{diQBkIqĐ|=>i? QxHh懷.s]Z@0ZI 8Opڇz̝L4;.$d[l %T/WW|Gj9z=̷gFG_8qqq 4q<">P)SYZyvT?ꎾu Wrq%^ԷlKlNY~e\k#_ h~]< xOs5)?zk}ƣGuO }?~w2Nv8siTdw%[v~eΞ'WwE8id)MT}֎5DDE9)4y'%<\Dɠ#iC tr78T][[ ǫ{̶X4-pIJ7K,Hm%c.2F]ݨ{6KUb[U{:0g_S-'|qX!lv65-[f$`lnrKh->pEY!h-]M)ZS^6R{mڇ >[LI0r͚QڈKWb\bNn7oیkJ];F?'w1w-LYLvR}X0W}{욏\9c\9TkfuW[Ycǹ =it{-Zvq]ʸd,r8K9-n#pJ-9Rsv}\êtwQḽ#{9#ɤlvKsc+.mSSGb| %Zh*W>y8ԃϽG}7`,s%aԘ 綊AFc-[BwIqg!甼ZBoeK,mdkk7J[yn:|`s0?Cz +Z(6M<4W)._gm$>y]mCbIQh䋵]vI?{ZbdH,$:\6'@hk+Y{5d2=ϊ;#y9<^/7e pilϫ`$WWe\}֟3e%.qF\<5<`Hu>+;hr-ct;lfvqqG m=ڂL|[-w2g3[36HuX=ӐbxMq>'9/߽={tT{ݿJsŽn|6zwNesmiz*yr,8dV#XɶtBG@?lU3e4/dZ\h876rnbm2Z/Os-4R+YU_?)Aҟ\0A wO%;=ӃJ⁸x52R7u4]p8\ˌo'[Hڢ}]={T<;#s!\1{P-,ր\\Ou+YҒW>WCGϖ]{#+XMwr:1}ֹ+<:almk@UEi_dWKn6;,ƴ=һ772Cn7-A!9b: 3@J.vqegEl눛1s~|d< ro>|꽷;r4c3Uir-Y[9)3[!pரrp / \Lu ;GtOn&[-~{t9Rkkϴ:_Bƒ洺(I",ol$F=icPGQLǾ'H|r1ŏcC99kAAEeZ71qv5S_\lIyx8!ߨmaƖ; Lopj;]{{l~9Yk)O,u%K_K]-eI+(b输tgɺs5an,K͎'ks]\d0ݘK )}y_n#xkcI It`.aQཱྀz۶2X언c$iٲ[nM䭥!,|#&D^D@l=w@ y.air4}Avjƹ"GU利31#@xq~;Hoi-48]3˫p UlZ1 0콟-Y:H%"גCuۉنۙ]qu6:LMtl^9"fg692v[b_EddqY97ۚI4lкdNx8r4h|cQg^vGz4{ɳԚv[㵖|lW(d9VuA1Sgy7,i|-E=m}/ wd2[[峖D].dmgI'Mhuѓ}OƏdf)kG 8ҟU7o;}AIoflaƽܘd6F[:I46+|K1VBGymn. [$tSA+Y,3+ ^EW A $E# ..-,'k[Y\[@E4+[$3C#K\EQPPTQ< <#ÑZIˈCO8p1m[eώkZmbc7  5k|2pOK|{pwlXDd155<<ͻqu go`Inr#isp;qpp5<t] Ohk_eWƬ5Ns?Vxr^Kl2WQۉ [X[X5C!/Ap>ywy{ˬ]c2h'Kcqڧ?&YggjEb3(qꎑ|u~0~zzMbQ1c2" 8NӞ|RH"_!u4C촬"=ˋQZ|M"C+K̕b>I%p~s;ԸN"ٹz[J-}S_eoErkLAgUrF}>lnKX7.!k~0~#O3%psmhh{*Uiwox!g~0+1}w@21#aA4_˫0F_V}Υչ7rL/x4wIdtn g9dz;Cy[b?W)q&mVxo$ii荷C+/QykB>~_יw7wtŞ3F˩Ck=4U=1M@kSǎ..#3=-tL[n6X^K3[dlFʚdE5VKk9#bgkZX ،-?4myzL~Wpu#iM/meJCck|,l({s5k"|f836f sC[{}msem`O< -ɲޮ#44<5淌M+jvm"$|6|h.qil\Pںu$m~3 (6gWo3BpcoelcLGwR-Co VVF>x$-,#29_Lv8n[lF8t0>8c[j8ې}M{z3[|:K>t۲[_~ C-D}qְjb7.^mm؋BwsNlYt~-7<.dt\syoM2>VK--c=sKkgJ}un6Oex\;\5ßxkOi\kׇKs쮌Luךkl'uec淺J^IK1̧Խ'ei{ea(:{:6ǐL,2\,49/oz iL~?Lᰖq8\MV+ f hr!{Ǚ#S⽗`iK,3m :ೳ?-+x66m5$utg݂+Íbph#bkmvq\umM+\I]cm 61hkZ@t^@؟-eHkmԖ8n&)ZOE7QMu{Ē1/걘6c)N5ֳz+l\o3rZ\$m#cOuTf1ػd }b(zuQC7Լۍ%;ɨ2-c pغWyE2a,ݲ;\ւ844HĒO]=;i_,d67= ӥ9=Np $7Һc7mg fanRcz]\abs+tWnoRޗ4>2D@"\ss?H,1 ΪLf Ik/6ӬasOʺͬNOQ׷GX?2{-O굷qtPHZz]P걆\/sRHƓ{w-a3\I[[I'\i*\MI$h י>+]c ɕٲw9ۗ^#FapfL"uN5iฃ#mfFmČEC3ڽ#zK[Ï_ۍ=ĒkZg\5tGj@h{44Ơ/xhktX:7ZHL,dF8lX"Aw+3Dֺ0:wyynllwO tQT;{p'(r]gk+}#Z^j kEGZr}c0mɴ[Qq5\NwTk윇Y'o#7&28sg-_ {VmBbd$PAu h7q$I'_B4.8A rnE{˫v7׫/rj`l反2O-O%m(-O5 n\sksgaok,F#""ڼQ#})dq`"14EâirR R'*ּ=l$m9K,M՜ffvn턱R^9(xҭ%yӘ381hceyl'8|4hs;ӱHn--Z {'w>gV4sG*"hDw39! /c'Jthh9[錮V{ 6Z:b+s>hYˉ幒WdL>Yk:|Wz|}|E+ŸXq|C?}w# q[Khln|׷%9ٷ@wIE\{ya0ތF M6RC O*Ԋ)OWx|I^LNhkshsbdw7wE3|-q3b E=8G!cΗ.%hh"qbžS&e͞F;90}nkmq ZC܌L ##^L2D%45p&'ƵT.bFZduDH ܾQ@/2Zu]A(qk xmTR9e 0N`еu'"JC$o53Amϝ3iK+ǚavè=̚9%7BO\DF얞Eq&iy1v[6tw0\i,&r {8_SQQB+Ms2]M=M 2Cs=j>ɯkKy|2SڼRT+|'t_]\cfrWvX<<;`9Nb-!5\yN}I<ۨ-鷊6סcZxKRb׉#p1[#$-4cOV,˸$qyӫPc uh{e㦳emdv_[=q>bטрB8qZfema{)EKu!v% 8V7>B'cd\e{Kn}<0Or7i(ݙn` m3u=PZ-y[6M%] .<.\.@ChpյŝFy/$O $ymbS'utGha͒vɒ0%alFވ^.k]ˆ 8c:FX+d|o>ddեmm v:O26%Imgd1oIX86J-Z.^|47sKv닁H㹚' |R'{%Cw>>O2iݾ`خ\ \жB7X&cl8\:EZ@@Z=< 3)k+b[Fd`,ꮓ˟!` yt׏m⼈_4د6\GjǕ'Tn,GtpE]G!EBꭻ`ۇ6t##MmeAsBA vިh֓Jzz'Pp&|W/&ȁ Ϟߪ7G yAܦ:86[Cl:@9ys:A5T%06AsFҁ ]6WF^cs_.kDmsp{*WXm/D%0֒MӀ5jOU`,"-22#f'.lч9y!QGOhUw>T| vqA+LF1C[#@jH9-ff_B,Bm<߃roZj76{?&A4#F×  :kE8xz {I :.M*,M1 Ĵ҆ `Hl:QFUdctp&.#C#C@p`UգA(xqh-Lm#FA1BZיI| :g儇=Ii$Uo&[K{_p ĶC[Ē4\K,HfI{ϑh W&Jo6kyqw[Zت4yWInb1I !-,їC,fTotlk] 7+zC$@CN.T(EPtkϑV>&9lR1h /8J9h9qR\5HyM|Z9sN׀ :Xni=<䰒xn to6A؈a{fsiJUA&%8jZ#XynҼB%tniW0D[[)mi> ;+n$}ń[^GdDҸ`/" _CwQ;r=414GuG::A 1?*jAu%y$q![B9WTZF{(S󓃏D*:hSN(A+T8<҂GPІ5:t .tcIEXJAC.EY5F*1Y "2IK{ni$ A*LG,I(caaJ\#'k tGtZ퐸m<}*4 ԴHh잦 G}ymY4*ˎsfHd65Cy $)mlғ$6W]ZZ΀HM} [kide;󵑾)kC<޾+BCziCSM{kMM klf/(Ţ8:3ÁYym,|!&*.{ zM+gZ\o%zyda99=E-Ъ~DH[StUsW7էSxЊJU:6!ӗ5.o luI> ~^hַEeŎiƎkZZ:Ah&5ȅ_^_dօ><кY1_i^o CХe$={$15|tJHpYf,~n~GSmLOI8xYo އys}<= c-Ѹ2e/u :@ wqc#k ?LhqV1v4De=B7BP)I%<'`Y4h|qs#ked/8=q&[ l}fF5W3SDB|Ċ񱒾 |qDuB+Zq32LGgWXT([ZҔ$L 8BZw\A^5̸频9noe߭SD۱H_c. h C{=:HEmbKk5yORd؈qhj} ` ryh2W7)Hv=-~O699 qXjmw59p-.sn'ݾ9﷖i|e"""óutlޝObufcq|Kap-nuٺQf|[+L]y8ckeֵd~`\8WvC-ֻദ^Nc1?uk]E28[@m2p7W\J#l kCy;P=oeuX=kf-#/6H%ż h-p?G\mfMҙtӭ3wQ1;)G=\1[[Ȓ /'6H9%w{}ݝmϴkLnOJՎ9 9~xÛ!6H,2dח/Md;79!cq7}tMK\~v+?:k7FY\sN^ZM͎ӯʙ6H$//ZLP% &6SL.G%[qpD%*I/ w>X}Y(`;nS --ZzK7۾lqpH"`k^~uOIc^YexisJRلp|{{k[Od"U;%uRx( ?8v`-{gO6\vM yX5 62;!6f-ysFe1{|sm+ctPL=Ms\e <8xc_]}~׫=nV9^[o$v\[?hlظdSkAip?_]3ٛBAV"}0cit$D%ڿa6ONj}M1o=X릆:[N?^[Yٖܳ„]sޕ؏aZw;Ktl&l-M5%{̷-sm2'g79\c!+ cRp Ӑ+.cj O-a.dϵ.c19fi e̱^27uk/"_#~zFL}kfԺGJ`?jxSY^cuH"Ioao$K 2GKwHaC$Q0uZ[WM i|+^Oj-!ti,Ơg kQGۜ޸CFO^=Ac6b#|IOayr"""""""""",ZC>њ9V'Ժk+}ar6 V[=D2E#\+OC#%G,nd{99iizQh+Ti,cLj\Y.+>k7ܦ>k{+_Ea×~e񸱂k# :J؏b)<+WE*~*Nu^N 1ywP 2q{|N͑Kokr_ 9kKkRbrX Er 0MLNWy7x6HgV2Hc\X>79IDZ{Ik +s3WOj ^C dټ.ZewRy; ⺱X^@FHak X*Ƣ""""""""""""""""wv'j79 !8/y.gAC9rX6u!Now.Kk׏ 4Cn(Ow=;fUݰc-Dw}0Gv.c7;p'kXnd%w%+iw-tO J(|ʴѹKkqb: Ke-^Ehp? 3vt#ow15m5E=I8v{kןF[8yβ׃~P< """""""""""""""""""""""""""""""""""""""""""':O>Q|)ZpA'ixzPz||}Py'ExTqxر޶Y \.+A-1< . ȊPF<3кC#f^KĒ =qp[ 4SNkVhCst主LU׷Qy3c3< O8ap>{;y\熆IwH)`6/l&R2XmmbeوZYZEy .rs<&'žl߬~X~\PeGc@1FγgD=d8sgN8mgmk6ci de7bk ]_2(6u,uԎqy~6[u_Sh|fXEa˿ /~2Llqi.I#jhM?c-l/0qX9^b/^Q;2v}[̉=? pFFk,Tk뺺I1t2т}k||1z1t#ξs!l-14pr8+1KC_@xEmɧ[C4ƈ.]cz#cK2OԟۓG!k&n$`ot#O'HǺ<74 Xp٧Z sƋ6X̽@!Cqr|s goZ*K| ÅMyq3>O#9k[m֥ROl&|1f_Bް،u'-4TXmZմCWPhQ]gl vKRAȺn-5W1ikQ٤UqC:%cȬ wCz{:K\4TEiug/ɬݔa\[ '&Sc3Z&y$5`6NM>ReԚ c=۟ Hp%( Zhkzei6)Rdڳ >dAl77Nh|.C#ZZڅ4P>P55tM{e`XQA"i0>&79KvfOI{q)k|CDlhcLm$)eК{iwyn,pxh,sq eOsV{dkb.W|c/.CgᠶGz-M#5@څ,PMs//CO*(<-W(Uq1B9M?6$RcCݦFk{K#pG]rŤLtyVtč͹vU̵Ǿ>ˠ7*=Piamܞihug6 kr$1zhy4[E丞<1H|H4 $քPdgyɱxt\RHMն'niϐ v_L-4cu$y4f5vs7?jqep`Dbo{$@L&H[QZJ͍:t&6xß:YY}n;w]YY@gm^WD%ԀZS#1l2ݽѣ=Uq!oʼ$W&I̒8/S\ބՖuaڙw Mb;A-hO,6jL>L 8$\bag8sNV+-F@ 1l׈*w[5/6hYq/}e6Y,l/H5 [[ -SGx |qflcnef;-d&`seeRy1 }-dWh6J/9[wr00i/jO+m%'yAw 5LMfmwHAlw-**GE$nb21a2y̐8Q׏Vg{&3 oCBY2(mDWrΝNk PMӑ?TEkWo)1Ehv'A.L}qAKa Ѹྐྵw vck9OE>bU6gD]2I z$kǹ1p֖з.a.~B]#LQa5ZuV%cr.ձ`O'^۽:ten8!~je楓23P˩r}?nH'1gҳ-'K7Od29|Dl&WCkqq)eiu;`mikjH*ki-ṂKw_@jl% ގBO[ YMCko4nKr#-aYiLj.36zsPnMÜLp6dc4e]Z;n4ڏe4"lf uֺH[2/dm9Ckv w;`ՅkEL,sunqx%B` \ݱGrJmjxrm51HrQqvI$m-<{w۟qjY?2Z,&"4B8okZA,\_dn\ X^>{Vob1:^q7h ' qdbV/cZXxbgXNKT1:]F>lNr]Eitmͱ|tKOΊ{&_l8=iuwu^c0o9 }\xdCHh~#- A1-id&-`{XǗDmlq<68߼JK40+.X Mat{tF6Z@w}&8C^jW.EZY^2yL0DYɜhZL} E8D~tK~wAmrV\F2飔? ;>KGp4ޱׄ6&΅'..db&W8}55'xC>!,֒#o5:Q5+N@$m#UR#P9/keN9+mߎ2k_;z:>Q{^bafP˹8,-Z0_ A_>nQϗMi]$1t1ֲ 'C}259-N? DZ}?}FXIJY授:VA];Yد# eDM7[CqwavXަ8 .YY}&2$1e`uJɤ[D-/c.K*iS}|޽6"qWpOgd;%|(ncM㉭i萊  ]jv8b'`wg!?17̻tt$ttQu\dJ-^%c.% (hx6Th*RKpQy;|޹-X68f&K07l-EG_^d)+i$@b,:S%o3CkαYm`Z.G%sjA?8Ž->UzMkȚкw{Y,URww@7YD؉c]51\E B+ \t躝9.cL(yp<.by 󯤸0~ uIQ=LhQmO]Vljm:o9TЅiYiy`fOÑzl x tHƫ3&q] 6gT$2Hȥgkvd+QUi6탛as"or#xy:J $4;U/"JP҄½_nik q1Z}Im@G/d=M&7<7>c]Ҥm?l7Gkw F} ,Tj;+L:xy}JL)[k[;G'S_l +LV xZWa[ȻU.6rv]\>IkM1!.263ƆI D* A*UpZ{C.~-[ss38ˇHllF{k" tWpd@6 a 1약OS#!ƽՅ?"O6G-m)irۖ1x]Ci,6JO H1°P8ׂ~e~_W, oգ <+VϴTƜ*?W8~/ln.(23ŐHmWNY$qX(" ҀШZO,rۢ>#[s|W\G><WOr#dry|8l,Z-sY6=o-*.=QjIaqd'$PE9qO443erWc;bvF:ht@,hd2C ͈0t4i+I?D Ɵَ@ 5=Mc!=i2Z:0ڷJ|ͤpc+ ]E'm0hqmrO]AGqp,MFMi dLc](l}%w7h>QEP|Z۫< :Fbrn]p~6+͈o t3ZhJ-FWIqZ)]kg.Hd:X떼./*2 W:i[N~םEsWy`6@Dmn ݽ1wPk4,FQ۲V$gqgO1w˫Pz) _ynqoU5zӏ%jfG atWhYgmo-\[ /qk# "qEqvK"%|4--a-!姠Ƌ#e{V$/5dͨq,%#ih;@cim^^\:{{̍͋-hlHFI!'v˻B-:"픰Ew:7]Cd ]@V&o2)XN4% L#+q|]v n'4akI =!hwK+mKo$vF;5<:xS] oIM\:oOsCC-(\At}q_n̞2Ml {vcW?>B+'}XOwkΉek[-вPCZzOKsfζ4Ĺ|^gF id o\1`le6)m79{i6.!^34ANCxqvZk;k޹U˞o#LoxdNW+2XA.JHdmȒH$毆C,68\ΓCA:-m7s1A+ 7Ͻ8oʘ52{$W-;e&YmY=6\GVIQB܅Q ٖ:x)zEf Xe< tVc5OŝGbu\X{Km#eVsrΰ/f-D\_.4Fs,08XLpl751:{Fe408@pZNn4qk;#dWha3$ᱵ֦Y SY4\H筰8m?}dK#')mq9'2@4qB[99YoRd͑1W ψ.ỵ̂9oVuJeqQp}Wf.2W}嗼:6}ll2n`  XMNIy, 6LG=ʔu(Cg`r9epe}8K,֮oCݲDmqkHG0U4.q6y_=|yqg5WCq.98k+[K_[[#c/m懮5!!SGV6&`xq 4hsYJƀ|X O"#D!̌֗BEG×µ6Ewțjȭ<%ӡk#့V?X}{\\GjŴQ@t3y;0ls\6&2[L#d^hHk]3[-cH HR >Ju8g1hZunq#wK|(΂ DtLecko֙&S< *cϊ+bِC,q-}KUB|mN#?~ZLjᶚ-EՌ`$a I J\Iy&;g:'2.Zlț7>f:N]m%-ӭMm aȊ60HwM>Xh¤R9KƄNji|'Sad=^*HIMNuwO`$n_րK\)j m]=+ kLy"#*q$Pd>KѸ09g[W6GH 'w1 tQڶ[N\HsE(BjU+i3kmH8^n\c{K-1$WDP|* o>u6|%V$psLMHV4\Ao3*ΕGrNE\0Bu8^:5\\ r 52q[X:y)cOL}u)N7s8*`uԭpѯ#T1;ƃ<3&v_8:ie<̌kׇT6kw־d/7Q2AQ ,Wo-֝L>[QFM3ccxsZ-M`׵:y~ oԋ ^si8jKq՝P1cduH\4GQT x@~$h>Ud޸@wZ+ʝ%/gGYJs[a|f9-. dо1涔'PҼE8P6ok"% \PÊ6@ W`$T Bu2P-$i$1͡ QE}mngP憖yQtq!n;Tv Z:05.@=hh,p jiAW3)kh׳ޯ2Vx(2:7мV4+ݽ5Z nր$sKhXcWo q⧹cKь.CkzX:iS̀n:dw>r!{}5i)QGkzF S5qW9$PS #k>.qh@\AG"e+.0ˡ׻7k[:J[6/[:Z)N0Qp UM#<[d syZhZ> $b'Οg԰4QRXr#ΏczX3Z)ҁNȠdO s%cgs: S C֜i8ZO^Gԍh-h={<ΒZK$ OU[[r M﶑`xJO/R5 c&>Wj R_s'%q!$ (26{nwPgO}"h^/}!vUJ˽u뛫uR5O‹_)5RZ||z_w^C|G| ˧KnEus_:Y{>W """"""""""""""""""""""""""""""""/rOjW^uox-ݭs|e:5a>TG~TY؈6<1bqR)PlciGY1/5ojiIN^e3fP轋Sg Yˑs-cB_)we_pQnIns;tv&IȨ .m3ls. o@LN\B{*tA5O5u8|Wy^{џծ;+yCiJmYL-ц6F`E]ZDDEj=wwzi{l7sH=-5,,Yyк!doY,VdsLm7w6fS7 fKYerD)"bZھ7@xR^v{~k?u\vSrnԒ|ڽVLh9iZq[[ l Զo_kHOCk;VV8̖ 'LDϫ\6e$]9}ni|gy PwjJgP9CY`B^ g7{oys}#ck28YeեL#DFopufvM|͆K-|ZOt/t'ڞjvܻk}eu˯mmۑ[,>gFycZeu.[1[4pTL cCO$旿E;a\n{e]I c.l ˭m_L% )^X,/3IpR-+<?EvZ[ mյuz<ѐ1.2H,gKKp4F`5CQ4^k ;WP綛n0:GD:N?x|؜mj<&*ٱZ~[#s(/CGw6 I;Gv +frll൷`"qi a{vᗤeo&w1q l7 qŢ8.|s:cEY손6-a9\6cq[Micas xz#tcTZoܺ7VKKޝ KLlfK[`ɭ$tr6p1c/KYFnH} g-og7.Nw#& hvI-s;mykcסYok0l.gǸ<ـsz]{qegsXu6>sZ_u5P2M'2/u MYu$]&m^;<#,RU=  7Ï^|;nv_.A[L{L 0Oc]mitv Wiۛڮܜ71ܻ5}=7-ANi%cusjJgֺZq;{Z؜wDsH5/m_~c>u~d5 O̦ 1cL0 ?zqZ]d,a-$hph/ vco{9^Gg``23X],5vt"\: Is |/rC(s:yA3G {[$~k M H?(r[{ګlXKl=Ȏ '|_W s:K׵Fϖ]vCcsi}w[l,oee9J^i-1M/[ֱX#q Wdm-y8 eVGPwkOQpknު͔kZcFvuԺTYY/"w4?)no,OLp/m7+vg{-z/'uk{ljLfUٛGP9kY$|o/>wmܭ#7]G ?! ֥yr-iFm`kc6y K<kK[˫{\7v+h'|Pd-o&f=p p 88@px8U|?_ok}{ki}N lWP[-}[^ m5Gk{ZVj ]ջ/h5Fj-펏n|fr2Q!g}F8^]2f3ڗ+`al^h/uxnII5mxҵ{˻jmIjLE喕nlxSvr[/f/9nwWW׷]%̎g>k^=ĒI+Iq.q$I$ԒxII+WW7773^^O5\\\HgW>YW=%q$J+uA[{'imG=C43FH湤5Q$jA>*O5M-żHh$heK4*}gzԻUVo, rحs!bnb{2ZfyZɘkL0=q7PjdU^٘hC/7CD{i0]k0Cl7e8ecu.?>'RZy?+kwlb--LszmNWJ-%l͎)|6n^sgq^ Y3[8ЖmiV

؇IB׶6)@Zc/^3,#'7Aۡtb|]Y4"9"1:kwMgO-5!45ݥ@(o_-Xڲkw4:}xQiaZM-wok$Eq3s}76~7(0=l" xYgn.3Sja6\bk ^#K, TOAkCo9q6SK.P[b+=-x5266O6g$7SvvvL#5{oZ]C)kqv8m^@ey.JXM[ߍ-n5-]{iJ]^gH$X8 g{1Gګo!͓Ŕ3-/MaueakYIZ޹$tOSWIT4>H1nm|pQ}R7I%A,3vZewfK/;e˧aHW<C]k-}xam-/Ms,60$q/-UqF!|pg2yW>a>F6g<5&G\KJA 1;y匥gI篣Ɩ9(ݗd8>\JHg mË263@__7In%O;̡HAkx{쟏uݼZ2_Au9!fc᝔xsAhk5;pmXLƎʺ+oj ]. |}oYɄr68;{vceo:)C;]H`/k_4m|LauvBևO.+4j7NNcq 42;vyg܆' ed\X{[R~ŋ]!vP]05He[ߒjx3v:@[mHf*}w-?{n8j=g7uox#C&gJӶs߼7 K,ƈS ܭvgDBs"?{fmc V6[sK&v '#mN)4:Z!վkQe"WkPAaiдHW. W{icLh_荰}䦍C!=Nkf8}^mm66Tk܌W6?W:[Iv&~?E$:i~e66^-YMYӚ(d4vK !ElqL?E1r.Fc[o"eXhn0#5R.nW'9}牠kEk꾛ҺWoZ{ttƗVqgi$u\M}&ӚcNh=Ҹ١SdF^2c*=: ]@k Kn7qI_a49u3$N x+Xj[ECq+q5R;%3մN, Kϲ uCiOu'D|-sC%(zm);uҳmdڛXTp6Sikk3˚Ѧ=caY5$K[F:!湮H|\zI(֚+ayl7V^墾!c;+ז6$9 *y6V!uK˯c{|m1G4S?,gŋ,\nfxg&igY$.{d'uW"7`.n:HDaK[76GNu"UR9kcvևZX Skgh ywK(֎Gec$3Hζd#;vRG(/d" DB\x>Y7#| fR#3n6<ݽ9d0,| %YI{Wۙ\zZfzP]]]%kGKx/Z4B4$u9эm]姱[a&#d9,uL~1t2K W3cxoGRL\ nndc c$pc# kG[ch4Q tgQ_mogsww;(3tw!`q>SxuҾШ C }N$SmmgdPL# /W#zፄRـpސ\^8q N[6.e/6[K$f7&4=Cf[9kl&KorKslwl\[ -pwՀ8=P4$ipuw]jqqk'N>;EF~4]y%ySz 8f=oqƾjDYJۋ)Ơ\Md 0Fvc>!ֹ 2:xn2V!tri3Qc{NtHd`< œiΜ\Ξe6#>VGO~q˯,rz Zo3nsd茗}bv3W\j3-c1ϾpWL5ܬyYXIxɪIEv^׎a Mou~96w;d.dkdt,<јG#JmSh:s09r8;bI^xQ-9}%gb$NDzX׻VyU[`?)}l?=]\8,'ehKE*E JmMC+DڻPO8xzם͗Vbo>lIJnbeU+"q)/sP%bQie#x&NI5^$pQ8rT?^n39qnU7VNn>!zBKwJވQp:4.2im3qHMhsd`5ƅg!CO| i.=eJYed#k+.>A01h.G[3]żDKaqZ$d,|9Vyz }lXYEMȺぷc9"GTZEye6ah> c,k_]^^kHYueK[yďL%h>ctoծebš3+ !Q\}ZNiOEi\1\Leq:lK=3HX#c(xA3'trC+>^s'Ys+AORzHpUgWhryl[}o$m\26+LWlsG ʕE 0 q#27y-'7i.tg,ip+I晓n+/s7xƺKiWq#e -kuBoeâphe#,K2TÚ,1:.zz::t5%V9ԶY?eᱳ8xfX-lyyelj!q(|6OKm8L]GI@YN,]͛&|޶Rf9 ~58ڷFo'>*()wS\Bc8X VOJͨEZٖjX!H^d2lUs=S\j} tqL'>!|WM#6ƋXK/1&ͷk._6:I}qGm_J ^$^Т-?;7pV%>L>k56ŷ5w]%cg!G)=v_S#yגsj]5ж:tdk-rXKqU LX`X2啐ƵC.Yoa}kl m弊nB;PX/doG>:,ݦOo6pyYlr3[`m{^,uhM8KWr7]M0B߮Xu6 ͔F|n^ @e[}OicokWcn okh$Pb̋!c+y$kvJc<:3Xƶ+X\#,"8rzNI"3,Ioh%{$&H1/騑(]SZKqmȝ({o w_HOI-2^/[1k,ms6GD,dk Q€e|wLAqs#ꍱtE+rDV:2XN.ZCR pifK컉1Ѳapf#_!wIwIZԐ >+a9c%FLUikJCF~Wʦ"nJ&b'ꮿniil1D;򢫗3/n+ru2ZuvzKϠ܎7_]5okc1W&[[iomF:c\GkNFդʂ:u>o.|Vs峟i1e&\m M}kEk1^hcH~ gKCρYPS֧uj} ѣ.>!W(dSJU|m过ʄxD襆+1e%* #*)p@:=:lpGQ/sׂGp(8P kA$񕅺f!(k*9تOQ5uE_HWu7FGXI1d{fl.t_Ȯ>qzP[c.AptolEbkr%Q@E8a*Js? < IfzIo\p|{d' @rVs&A12t^@gB[q,Q%VYc dh.iR)Qƕytp_U%|DX׶Od7pW y=6Xà&9MqdOcF9't$Ҥ[h9)$,.4 X85>1|cMoTxxԕ#+\X taEeMZ MqB-"I2H#q|- 4\Czkk4ioSdp44s|HkWPJ=GΏR<6yAΫ[׆=R48J9m?{QCgH}|CA,i-q{\ڷ^S1CÍOOH2!WN̷ȺٌKLk[;đJP{tkd]QJ+-bC]@FPtU;i-cl^uH }PA%-tuH! H#V[\斒h:=`7kǏ> [,7n4264HEy 8M*[}?mcAz=뢻AoeoSfoV1-ysh ҇61ѝa>Fз ГJ%DuE5oiͧ{coCM 8ttW*vr޲F#x|5wS 2O~/BO91}+B(j<:WU5ӈs[zK*qAWPX4]3e%/u4~ qs> u*5O[U " -5uxT(CăW 9I+Cǚֵop!8T[jU.JhG[LuԐF0tկ=$iSgI-HƼh$V$<szzk|jY\I,>̠^iSSWqn!!Dm`FxdyO}`JCO9ƭ@%XsΰG7.RƢk74 :Ac)q?ڿϧ_tҕ8W׏%^[%˩Z7~u_OлOwn_@s_ 8Α0WKn興^Юnv]}װmi[IN-n5]ŮVdY- cu3z{rK{R Ϻ#" Geq Nn{@լld[>ckj\-׳b tS߲J/m;S;)ۻ1y]ȵ ˳Ø#mn6?J}^G9]F昮@;ֻʈ-@C]p-gh"F֞z c߽E=:pqEvxm-#Ԛf1[\KqRKDDEwNw7 L݈ͥWǰ{PW+%tV2Hnf 4n׮[+'G=У!G;^{{oqLGֶkdWwX΅䰸11^btO%p=P6{}p1:m܌*mM]i$טQd,b3oespMAؙ.p9K$岞$ 4\* mw]k{uga=Kjk΋-K-d5,Ys\ wqq|dʑ}Mpovn>{hzzV:E3zf+:_ػKɰ_[6ׅ7I M3-d<<'G6{A-<>=E-jYAmVMi+;:]x[qW}_Z0Zov^qv] xl+fk"Y ,WL6w4u qdMg-.NQ]a_j sښX4;%kum|{oK-4-A&;?5clq0I33:2^I /`px@TB]Jr'y߬ClCdu :'{oxwbuk.o2; /$kIj Ԙ>/X[\uZ絷7D Av {uM=]umrGG;a9I"B/E{219ҷq,\ͫ;?QIiai&CJ~a't^힀a{mDA!lʊUFO~u^p[#ݲ O~Uf)n ye6Y=,sR]k;Lsetrc$ +%#%5쳛Gw7>(mjzk@ Wdh=`8/\ƹ7 2k9y,5mdt2c#|`iEv㲙i6/NN,nM𛈰9;٘@5;n/ecOSq!P}f8Pƹ J-m~`'=֘=,܋3LjFܮrxkl)HƞG D ;PX?NhvIdC9˸1X4wnkP OlG5^HW;\Meq.{YmeYM#GV_,$[-&9eW+qgJ㥆,C#tG9U%룐M=-d{};]8멟лab18k7='c>~EMyy# .(ZCԮ{.ͬu=۱k/s]#,NIg5t^2]Exoõ\hHW/ddH {!:FK[p=zg@Y&ۛN~TiߨGw`$-2wd؈.l.)%xu%f686>-]c1xI9[r8k$=c95h.sMh$1^e27PXYonl6֖Vv̖g265{Q{gHq{1ݲhKErMS~[W;{g{ONǷ5q6rhlH޻=P.z;hqړxn;wwᶺ˼xomo,YsXlnq63C[9.[-.wvu=Փ:$ !&4FGyi{#c]+sYH$s}Ԏ"E>~F{ګ{Io6~əE{sf$-'tí:FGumvG\Kx^:Ӷ1p}vዲ%6s'і@s哤8f#zYk}ߏ*Rh9+؎;R3`ql>M~d(絑 B|..Ϗ7G `y@#hF[Om;_ٞoEb>jS?="ӹ ^D#[֙,l[6QI5ג?p6yY26O<2]ss=66R?s-SÃCMO/{STZumOgݮ4$27a<SKB3.`^dv[c;/49 'n֘;35V:YtƫWV={x^:/WW˙˔ T1ˆs>>_7xG" J/#kii#yp*--4p>-in%ž[@o"3יM }<(0ڞYh>~#%6̛#u=ϐE0YdҎwHh8Q^gS۴[eem_58$][li=N4^J&MM8Ouw\ffp8_enV\e/3;m"k+Ǝuࢼ^tV.ndna#LBK.7IjL-yleerfO=7uEw=u|֗]^ŧj#si[;{-m\C 1gں[,̝RB! QyW!x<'wck{12]'ks,[.idM7K@5儵ϐTWĊVin -/$\[l; -V+ی}>)'7LWUі^xi䱺imli:h -ʹItrė9pWd~vwvEiuq%Rx.Zcd SY>9 tGkkªbjh@i^D.֘ ;|M7hqZ[Kmɾ }2qU#v e\ڲnAF8\[ZD6߲V7YhP+,. 9F f<^̎ 泬ۻفDkkmqK1!MJ'decM5w5=?l,YEsu3e0sscH$\gRI훖!' zə+$Ѵ\H]ҺKh8ȭa8(=ӀKjcYdT^,{:~.sbs]%.c8-'Sb|_EFmckG;Fzo5#mSakfq .[)ounpWKwVx9<\S^A+gFI cZ֑FKơPp5ń6P]G3zې|e>X2^Bɲ >d8qr; \n=nKKk[8dcuj%1-E$>\9tMu݅7NlIHi1Ċp6wtnbnS J}ݝ33l`FZJMGggi%dqPz Vr^ER9k{|ux|2ō[L\I.#lWֶ/2l,.L23wO%_w"y5HqPtv0r8hpsr yk>NWdFO -\A\a47w!Mq$Ln%彦JeyYFq#poexdL=|VdMe-۝[IHL\Q)G][Z,ts&|4Q.¥xɿ푳Xim6|^[L^Fj]+oeO30 ɏL֖?rfknŶ{yyf:I#os8u5)IOs\`Kq茖swFF0?ʷm" 5' '%mq m5\bOUɁʻPI &e5{shWnbKԷڷM__es6xm瓌ӷ6luW-drHH]Qג'Wϔ^Cqc\G[_R;]%2/zP㻦5 Y#/[z*k^Tx' |~ӽMkVg= h[i+6I/M/~z~5k^8r{lۡp6f44];c(KBrˏ#+Ie19}06سUFv}# '[vvzߢ5Emkyp o,qɢpciNgq^Ⱥæ,nm[?!n]]A,@C " amw.0=ԗ# (z< Ap&Zsioz3\[Xf5Xl/Q`pWz;2Ot8l "tϔ1HhlAWF^Y,0E:#R? z+B~)ʇ̞k4#Hkwp@A#mr2|"4]J"%toۗԣcmK\>lG -55ǝ5QCl2]SLf ZOSZ ,HiI4dmpd;X=g9æK+eF2N'wpGVo囻vIA"ZL V?uHOGmjM8 |j lAS5tmw"A&7PÈXlۧZ\Z9h0 cKw^;_9Xˊk`8pqǬ hm)Pe<d6I(F YJTh( (O=e$qs#(·Jn45yH<6{Z爥"Yz\%(IzxjkU ѥ#IKa kYB]ij!.æC%{ztNlea`{jGR \A ٞIWE)[ 46PsU~:+y`y։o1z,>qF!eDL89-H<{mE#wHwCks !qKN\ p5Cxgd-̠1|4a iPTs<(]W N#&4kh ;eǔޱ(.dkP}5t9R:HpQ3$[z#`{чDA>*KW:xFGpUn- PwO  o}~*-&su84GV #GS !1&6LtC^|_s\1{jzt=(9 :( 9|q dmdED B\L.i^?Ki Y+/Uk$Γhzi!zT@]ڴT#o,A()+K*qfqqw[Ús 6[+Ǐ"Gu9mzֹŬ!WW:N]SRMHJꖁj|(L8K:( POQ9(7ãsjbhi 9=NqpΞ`H'zOGI>2Kh VNJEYSPE8xx+@HtkG+A~x$>HFA=HCM[Ca{[GmK9=R \ N'ZzژN$U)9ָׇ]_-c|'?5ASN\޺'HG42XO=5ƽ$9k?$qoEJmyw\tq(F׶QTMoƔ4[;QVRB4%f(*>8q 4*Ցm=f7İ5K:zb3%ޗk!}e2!smrGӧ羊z҈ݽԻֽN䷋ܼg%c͖bm?3ˣtA,o,%q69bHZAT-8 A#r WK,<I a'9b7$r0F< *}wɝG)MewOY]lnݾmscVdu7y8:uӚmǪcgap͒pU}rv?reyYsyۧMs7Y:7.kH%y|u"l{Bg_KMCΟK1=_q]&sNf73aR6{6Cx>;;1Y]8csY,mqlloJvg ;-]9sfy,~Tq8Lk,^BjȾ3qsY,g/}weyLķw]^^Nswws+Gq$V)ss\8ԸĒJ~G#_eYR#_O%ﹼϚW>G=$J/_=wq1pvմk)_=őm~&eO54lָ1]LݧKiiWx>NmH:7H+uw뼭vזWP;I|և\gw^DY,lϗ6[ls羿qg۾d=0X}zUXGw41C2? |FE-٫>90ˉ"El ^E:ˉz{>wg-pNb? {WqAq!j.|~S8FauRZruVnƅ:OZmCGkwW~i]mm75'G} -14$R29G75.nnӺgW[JkXu6ҹ6T[]?hIQDKKybFKL7G0x c'K 7$p_7`N)Z=mj=%{ۥkn1֘[4^귶j[+dm@9 k y'[GA50p ?B;$3ޟhZ'ZYۭnc٫q`&TCgr-@da 嫶>mnjqm岡+;YqS~.dyvvWt ч4:abeĢ;\LgT.!|vpv]}ԁiV'kskqWm|%y{t~40斒 o&jw˭%ZvbGus01è[cC-Lb^hn$hbas~P^{SƘ}~gm:5ƘM}bg[l4Y'o_b-l6Wo}X581B uxYėyp@Ek{yn<6^x=uu]vWVIҚzl\6X5'gakq i(W}w}34ћ;h>ZG#my|X=k֘Ęq)z#\6kL\|L+Y :' 5h.սw _Lڝi}uzs/2{jl̶gMVs|n4=pZh;Hz;ݼn 9be5.PZ= "-WX%Û #Y^./t[FUڒGTE ~2J c;^gw; ~m"a5Dm4n9{Sdٱءc}v˱=c}w"-MjI,۶;vqBi^^w$~=n Ob`=Qo??,_Xi+G4^[=3F@,aizP*"""""""".6ݽ=k{FuUim/I뷼7EyLזEum3DHǀEխ x>4"{y:9Ej;oepY:NմtwX암Iouo$W>7_>u[[j'qֽ댜#Z_6)ZW.褺ײYZ32x8[5M˄ItHf<_3OP+=WԚb|YddںMYWG%V}2;G(#sh^G-]yt׹Gyln~4!{M4ͺEuZ˶L2srIqӏwT\jZ{T1 yQQQDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD>2<8x*@@&TJ,ޚiEԘ38ōdH/1p+HG$ yHi-siO^jx|R6F|ƒRoc)v88\V[Ғc\1i{ֵ944 B7#xEH-dZ5Goyir!szhH{TM? AXNX"As"qGC\CU~4彛3؛{s8}S$_ÙWzi}fsl"c{\^S$}i.2:Z&";]ZCJq<ۣYb{W> ˙[mV6wϹԗFãci+-Vn3Q5&+lkejϓ͞+N@\[@G:5mw.ޠ-Ԑc uevSy\_iǍ#kCbZ6X,(g5dKqovLs\iu$D[拭u/2OaGڱѺH-Yq+gi&FcX([!p$j}xmͮ>,-.,t:{&cm7v7m8LZ\IZS<4 -mqwi{krvWy|"<}ݖZM>4qk ,,w\cV=|3,ذc "[W8 L 7]ZUqdWQq#fav>+LWmnvr7vvPhT@C:?,M\WҺyjK[olqY-,qK078y%vJ L1lqvOd;Oލf3G^c,ny&Bt&R]˞νM%fy S; ٮnv:OOqa]ed 8r3'"X:ml&U/٩=;qu\4ZClCںg6 y{ų}뻛3NュVj _ Ld]bo ~,>I$ݶam<8~t~oq},t65(Xek$EΣ@nz/[e2f( mhY_5Ü_<|-;j,28..M5ȶؖ2(J<&@ hoH`=p>+KH,;@HGym@@W6wK\c`oպ,D&C$31}9Wk:Oul2 ϒ&H&|rTJ+( ֪2ʺt[-M&s'TŽiWT3O\0[ek5G4YX7 }͟ˢf$WZ2Ǜk )qC!}c9F3%+ٗXCy=1nltF$/.8Rwty86!^g_qv0'2qqes\q)釅Hq"R<?I+i/22ZEqm{6# d.qhCY3Gtpf:ɐ]GQ6 ˬa2狫.$,`./a_|mtycX2Y+'پ>ld%e]pKFC{@m0ƈv}swM,Exz07$e̶ͻI$NsK$Mݔw&Pc:gי 6k)e`Ⱥ/[iq!<5p.]Իa"ɛѴ\c-O HPkcrZrm~iigoi.;Ud_R[^q9mä%΍_M?yv7-Nnw3w0[ܙvyeI+>=Ŭ&F*YiΔdvn 38{jCY;tiv`PWѷh7k.wM% F;ɑȿs#5:Ϫ2JiYzhָl+Ua"#yo<1Ou&dO,.}iRkGnu|w1OcXdWM<z~Jrx^2ӳsj75s|dm yM0 ӥw.X.,x.^R:x|°@+8Txn:??4ԘA{mݥJG %rk.LRMYj.xȘ%BWH@>/r8aնVV1W}j(#|M!>u3U.M|Rۙ"2Lk4n4?7Ù_B6PLFjxgɴhKqciR~X}S_f,n"34 -Ԓ0"6E3Lʖ=4V'O|\۵lk).^J OOc1: !?O4[nV~,lKcѹMl-10pk=x zWk/,vmg]Xx+@.of$2esiqpuZ !$2IO$L d He?Pad-heH)>'킹2#qemwWqSÔ`9)l"o '!ز[Z-ƿMa{CPw?Zq?*`ݨa׬#{o,@]صF^ zGP5䍶h3n${1gI<} j|7!}9׷7fun+QL Ab2Xc8] C\bn#8 /!a~f*,WF 14qVlLx&k{Fd%,#5t5q|G{qo2H괟M)EK>ZI#^u.ĸ2Ja7C:79bwӽtz:iu"G8N d6 ƹ%AZ:E`ꪳ#BIh(j8ƄqF[n-sy.]zd奂(˞}s/Ȓ$M 9".r_E56fIcd9]7ڌQPV/Am׬r.c@1{T\U7[po9\|_[E5u]0c`|R/Qh3V GH"q0$|r 6-k>~Yi6٨M%{{ͷ`δkq<"HkV |v6xnL"oc=KP1ů,,Km#k8. q3 fRLnjn/1bYkt h/mf.Vɛ4sF*&6P+|a +{Is *Yh6DP.^\ܫ`o2QEtkp=p揭<)X<~By--k,$&~0 f6D[sDb^,<+sdcdICA`{6@ԺfhzMhlޛ\n+ b/ fY56%oՑd"xhTi,km$1O=] &x1ܘzxRX 8Jܴ"u\8Fw:c4GCrU/r:&;r[kWX j5.#)ds6bSv;qdI؝$Aiz{A z9a1FmH]_GM$s<{&ܺSKOrLcImc|dQ7,w[aqlIF$f6#GG5c d|,'Ȝ27C&B_2 6=( Á$;>~[+6x чmEkr/h2H.]Ò\mv0Kn"o+XaOK6ol<Z۱7q>